FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_27_JM72_3_GTCCGC_L007_R1_001_TRIMMED_prinseq_good_NbVU.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_27_JM72_3_GTCCGC_L007_R1_001_TRIMMED_prinseq_good_NbVU.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9323519
Sequences flagged as poor quality0
Sequence length12-29
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACGTCCGCATCTCGTATGC495221953.115341964766735TruSeq Adapter, Index 18 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCT1502791.611827036551328No Hit
ATGACCTATGAATTGACAGCC1197011.283860739705684No Hit
ATGACCTATGAATTGACAGCCA1128341.2102082915259784No Hit
TGAGGTAGTAGGTTGTATAGTT1090871.1700196031133738No Hit
TATTGCACTTGTCCCGGCCTGT975241.0459999062585703No Hit
AACATTCAACGCTGTCGGTGAG829540.8897284383718208No Hit
AAGCTGCCAGCTGAAGAACTGT813630.8726640660034048No Hit
AACATTCAACGCTGTCGGTGAGT800530.8586135771268337No Hit
TGGAGTGTGACAATGGTGTTTG764590.8200659000105004No Hit
TAGCTTATCAGACTGGTGTTGGC717580.7696450235152629No Hit
TGAGATGAAGCACTGTAGCTCT708070.7594450121247138No Hit
GTTCTACAGTCCGAC644600.6913698572395252Illumina DpnII expression Adapter 1 (100% over 15bp)
CCTGTCTGAGGGTCGCT532750.5714044235872743No Hit
TGAGATGAAGCACTGTAGCTC522210.5600996791018499No Hit
TGTAAACATCCTACACTCTCAGCT499250.5354737840937527No Hit
ACCACGTTCCCGTGG477960.5126390582783175No Hit
CTACAGTCCGACGATC473950.5083381071031228Illumina DpnII expression Sequencing Primer (100% over 16bp)
TTCAAGTAATCCAGGATAGGTT395890.4246143543012032No Hit
TAACACTGTCTGGTAACGATGT395370.4240566249717515No Hit
TGTAAACATCCTTGACTGGAAGCT377630.4050294743862269No Hit
GGACAACTCTTAGCGG323930.347433195556313No Hit
AGTTCTACAGTCCGACGATC323270.3467253083304705No Hit
TGGAGTGTGACAATGGTGTTT319790.3429928120487554No Hit
ACAGTCCGACGATC305700.3278804923334204Illumina DpnII expression Sequencing Primer (100% over 14bp)
CACCACGTTCCCGTGG299720.32146660504472613No Hit
TCTACAGTCCGACGATC297670.3192678644190032Illumina DpnII expression Sequencing Primer (100% over 17bp)
TGGAGTGTGACAATGGTGTTTGT294180.31552464257326013No Hit
TACCCTGTAGATCCGGATTTGT287490.30834924023858373No Hit
TGGACAACTCTTAGCGG282870.30339402965768614No Hit
TCAGTAACTGGAATCTGTCCCT281460.30188172512974987No Hit
TGAGGTAGTAGTTTGTATAGTT276690.29676563108843346No Hit
TACAGTCCGACGATC252720.2710564541135166Illumina DpnII expression Sequencing Primer (100% over 15bp)
TAGCTTATCAGACTGGTGTTGG237190.2543996531781616No Hit
TGAGAACTGAATTCCATAGATGG227250.24373844253441218No Hit
TAGTTCTACAGTCCGACGATC226920.2433844989214909Illumina DpnII expression Sequencing Primer (95% over 21bp)
TAACGGAACCCATAATGCAGCTG216710.23243369804898775No Hit
AAATCCAGTCACGTCCGCATCTCGTATGC211410.22674914911419175TruSeq Adapter, Index 18 (96% over 29bp)
AACATTCAACGCTGTCGGTGA210510.22578384835167925No Hit
TTCTACAGTCCGACGATC208380.22349930321373296Illumina DpnII expression Sequencing Primer (100% over 18bp)
TAACACTGTCTGGTAACGATG206180.2211396791275912No Hit
TATTGCACTTGTCCCGGCCTGTT197580.21191569406358263No Hit
TACCCTGTAGATCCGGATTTGTG186160.19966709994370152No Hit
GTTCTACAGTCCGACG176370.18916677276037086Illumina DpnII expression Sequencing Primer (100% over 16bp)
AGAGTTCTACAGTCCGACGATC168660.1808973628948469Illumina DpnII expression Sequencing Primer (100% over 22bp)
AACTCCAGTCACGGCCGCATCTCGTATGC168100.18029673130928353TruSeq Adapter, Index 18 (96% over 29bp)
TGTAACAGCAACTCCATGTGGA168060.18025382905317186No Hit
CAGAGTTCTACAGTCCGACGATC165280.17727212225341096Illumina DpnII expression Sequencing Primer (100% over 23bp)
TGAGATGAAGCACTGTAGCT156810.16818756952176533No Hit
AACTCCAGTCACGTCCGGATCTCGTATGC150650.1615806220805685TruSeq Adapter, Index 18 (96% over 29bp)
CATTGCACTTGTCTCGGTCTGA150210.16110869726334015No Hit
TGAGGTAGTAGGTTGTATAGT147250.15793393031107675No Hit
ACTCCAGTCACGTCCGCATCTCGTATGCC144780.15528471599618127TruSeq Adapter, Index 18 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCT137530.14750868207594148No Hit
CTGTCTGAGGGTCGCT136900.14683297154218272No Hit
TGAGAACTGAATTCCATAGATG130700.14018312184487425No Hit
TGTAAACATCCTACACTCTCAGC129630.13903548649388714No Hit
TAGCAGCACGTAAATATTGGAG129220.13859573836874253No Hit
TGAGGTAGTAGGTTGTATAGTTT128940.13829542257596086No Hit
TGTAAACATCCTACACTCAGCT126830.1360323285660704No Hit
TGTCTGAGGGTCGCT126540.1357212872092608No Hit
CTGGACAACTCTTAGCGG124780.13383358794034741No Hit
TTCACAGTGGCTAAGTTCTG124430.13345819319937033No Hit
TACCCTGTAGAACCGAATTTGT124100.13310424958644906No Hit
CATTATTACTTTTGGTACGCG122170.1310342157290611No Hit
TCAGTAACTGGAATCTGTCCCTG119730.12841717810624936No Hit
TTCACAGTGGCTAAGTTCTGC115220.12357994872965884No Hit
ACAGTAGTCTGCACATTGGTT109550.11749855392582995No Hit
TGAGGTAGTAGATTGAATAGTT109120.1170373546726295No Hit
TGAGGTAGTAGGTTGTGTGGTT108760.11665123436762449No Hit
TTCACAGTGGTTAAGTTCTG108320.11617930955039614No Hit
AACTCCAGTCACGTCCGCATCGTATGCCG105860.1135408207995286TruSeq Adapter, Index 18 (95% over 21bp)
GGAATACCAGGTGCTGTAAGCTT104700.11229665537229024No Hit
TGTAAACATCCTTGACTGGAAGC103210.1106985463321306No Hit
TTCCAGTGATGACAGCCTATAATCTGACT100770.10808150870931887No Hit
TGAGGTAGTAGTTTGTGCTGTT98460.10560390341887006No Hit
TCCAGTGATGACAGCCTATAATCTGACT97350.1044133658117713No Hit
TATTGCACTTGTCCCGGCCTGTA97210.10426320791538045No Hit
TTCAAGTAATCCAGGATAGG96300.10328718158884001No Hit
AACTCCAGTCACGTCCGAATCTCGTATGC95680.10262219661910917TruSeq Adapter, Index 18 (96% over 29bp)

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATGCCC251.965336E-434.1853223
GATGCCG351.0468902E-634.18531823
TAATAAC601.8189894E-1233.80304322
ATATGAC200.002870489433.80304322
CGTATGC5211250.033.71103723
AGCCAGC252.2012906E-433.53178821
CTAGTAT252.2012906E-433.53178821
GAAAATA1600.033.53178421
TCTTCGA252.2934834E-433.29832520
CGATAAA2300.033.29832520
TAATATG200.003090128533.2983220
TCGTATG5234450.033.18729422
TAGATGC252.3861676E-433.074419
ATAATAT200.00319400333.07439819
GCGATCA200.00319400333.07439819
ATCGCGT554.5474735E-1133.07439819
ATTTCGT1950.033.07439819
TACCGCC200.00319400333.07439819
CTCGTAT5217500.033.0028621
TCTCGTA5213250.032.8448320