FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_27_JM83_3_GTGGCC_L008_R1_001_TRIMMED_prinseq_good_uDjH.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_27_JM83_3_GTGGCC_L008_R1_001_TRIMMED_prinseq_good_uDjH.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11808026
Sequences flagged as poor quality0
Sequence length12-29
%GC58

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACGTGGCCATCTCGTATGC422946135.81852716110212TruSeq Adapter, Index 20 (96% over 29bp)
TCAGTAACTGGAATCTGTCCCT1580041.3381068097241655No Hit
TTCAAGTAATCCAGGATAGGCT1376171.165453057098621No Hit
GTCTTTGCTGCGAGCC1188421.0064510359309846No Hit
TGGAGTGTGACAATGGTGTTTG1098380.9301978162988462No Hit
ATGACCTATGAATTGACAGCCA895930.7587466355511074No Hit
GGTGTCCGACGCCGGGTGGATGGC893450.7566463691729676No Hit
ATGACCTATGAATTGACAGCC884740.7492700304013558No Hit
AAGCTGCCAGCTGAAGAACTGT720910.610525417203519No Hit
TGAGGTAGTAGGTTGTATAGTT642720.5443077445798308No Hit
TAGCTTATCAGACTGGTGTTGGC631610.5348988899584063No Hit
TCAGTAACTGGAATCTGTCCCTG585790.49609477485906617No Hit
CGCCTGCCCGGTGTCGCTCGGG538360.4559271803771435No Hit
TATTGCACTTGTCCCGGCCTGT493600.4180207597781373No Hit
TGGAGTGTGACAATGGTGTTT478190.4049703142591319No Hit
GCGCCTCGCGCGTCGGCGGGCGGTGGGA453780.384297934303329No Hit
ACCACGTTCCCGTGG450790.381765758307104No Hit
TGGAGTGTGACAATGGTGTTTGT448860.38013127681121295No Hit
TGAGATGAAGCACTGTAGCTCT444150.37614246445595567No Hit
CCTGTCTGAGGGTCGCT430710.36476037569700476No Hit
GTTCTACAGTCCGAC420200.35585965003803344Illumina DpnII expression Adapter 1 (100% over 15bp)
TGAGATGAAGCACTGTAGCTC369940.31329538061653994No Hit
GGTGTCCGACGCCGGGTGGAT314570.2664035461981537No Hit
AACATTCAACGCTGTCGGTGAGT305550.25876467412927445No Hit
AACATTCAACGCTGTCGGTGAG291550.2469083316720339No Hit
TTCAAGTAATCCAGGATAGGTT277110.23467936130899442No Hit
CTACAGTCCGACGATC269550.22827693638208454Illumina DpnII expression Sequencing Primer (100% over 16bp)
CGCCCGGGCGGGGACC268140.2270828333203196No Hit
GCCGCCCGGGCGGGGACCG266050.2253128507677744No Hit
CGCCTCGCGCGTCGGCGGGCGGTGGGA251490.21298225461224424No Hit
CGTGGTGGGGCCCCCTTCGTCCGTC246580.2088240659361692No Hit
CTGTCGACCGGAGC239810.20309067747648932No Hit
CACCACGTTCCCGTGG235770.19966927579597132No Hit
TCAGTAACTGGAATCTGTCCCTGC234990.19900870814478222No Hit
TGGACAACTCTTAGCGG230820.19547721185573272No Hit
TAACGGAACCCATAATGCAGCTG228730.1937072293031875No Hit
CCCTCCTCGTGGGGGGGGCGGGGGACT226150.1915222747646389No Hit
GGACAACTCTTAGCGG224890.19045520394348725No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT201410.1705704238794867No Hit
TAGCTTATCAGACTGGTGTTGG191580.1622455777112957No Hit
AGTTCTACAGTCCGACGATC190040.16094138004099923No Hit
TCTACAGTCCGACGATC188400.1595524942102939Illumina DpnII expression Sequencing Primer (100% over 17bp)
GATGCGGTCGGCGGGTGCGGCGGCGAC183190.15514024105299226No Hit
TGTAAACATCCTACACTCTCAGCT183130.15508942815674692No Hit
GGACAACTCTTAGCGGTGGATC180860.1531670069154658No Hit
ACAGTCCGACGATC176270.1492798203526991Illumina DpnII expression Sequencing Primer (100% over 14bp)
CGCCTGCCCGGTGTCGCTCGGGGGC173720.14712027226227314No Hit
CGCGCCGCCCGGGCGGGGACCG170270.14419853072816743No Hit
TGAGGTAGTAGTTTGTATAGTT166150.14070937851932236No Hit
TGAGAACTGAATTCCATAGATGG165550.1402012495568692No Hit
AACTCTTAGCGGTGGATC165190.1398963721793973No Hit
TGTAAACATCCTTGACTGGAAGCT160990.13633946944222514No Hit
TAACACTGTCTGGTAACGATGT158560.13428154714428983No Hit
AACTCCAGTCACGTGGCAATCTCGTATGC154570.13090248954397626RNA PCR Primer, Index 20 (96% over 29bp)
CCTCCTCGTGGGGGGGGCGGGGGACT152340.12901394356685866No Hit
CGCCTGCCCGGTGTCGCTCGGGG150540.12748955667949918No Hit
TACAGTCCGACGATC150060.12708305350953666Illumina DpnII expression Sequencing Primer (100% over 15bp)
CTGGACAACTCTTAGCGGTGGATC149920.12696449008496424No Hit
TTCTACAGTCCGACGATC139320.117987545081625Illumina DpnII expression Sequencing Primer (100% over 18bp)
GTTCTACAGTCCGACG138260.11708985058129107Illumina DpnII expression Sequencing Primer (100% over 16bp)
GCCTGCCCGGTGTCGCTCGGG137790.11669181622736942No Hit
CGCGCCGCCCGGGCGGGGACC137080.11609053028846651No Hit
TGGACAACTCTTAGCGGTGGATC133670.11320266401852436No Hit
TTCACAGTGGCTAAGTTCTG131470.1113395244895294No Hit
TGTAACAGCAACTCCATGTGGA130980.11092455250352598No Hit
TTTGTTCGTTCGGCTCGCGTTA130570.11057733104584966No Hit
TTCCAGTGATGACAGCCTATAATCTGACT129590.10974738707384282No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC128370.10871419151685473No Hit
CTCCTCGTGGGGGGGGC127360.10785884109672524No Hit
TCCAGTGATGACAGCCTATAATCTGACT126870.10744386911072182No Hit
GCGGGGAAAGAAGAC124450.10539441562882738No Hit
CTCTGGATCGGCCAGGAAGGGCT123920.10494556837866041No Hit
TAGTTCTACAGTCCGACGATC122740.10394624808583584Illumina DpnII expression Sequencing Primer (95% over 21bp)
CGCCCGGGCGGGGACCG120660.10218473434933154No Hit
TGCGGTCGGCGGGTGCGGCGGCGAC120100.10171048065104192No Hit
GCCGCCCGGGCGGGGACC119240.10098216247152574No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATGCCC206.879534E-445.20525423
CATATGC302.1001033E-645.2052523
CGTATGC4409750.044.54609723
AGTATGC1100.043.15046323
GGCTTCG208.898652E-442.90357222
TCGTACG351.7647835E-742.90357222
ATAACTA1600.042.90357222
TCGTATG4424100.042.14327222
TAGTATG1200.041.1159222
GCTTCCT2200.041.0956823
CTCATAT200.001120010640.9441721
AGGCTTC2500.040.9441721
CTAGTAT1200.040.94416821
CTCGTAT4406350.040.35644521
GATTCCT21800.040.0211623
CGTAGGC1300.039.9892623
TCGCATA258.6861735E-539.27480320
TCTTCGT900.039.27480320
TCTCGTA4402900.038.76991720
TATTCCG700.038.74735623