FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_39_JM12_3_CGTACG_L005_R1_001_TRIMMED_prinseq_good_RDL_.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_39_JM12_3_CGTACG_L005_R1_001_TRIMMED_prinseq_good_RDL_.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8216247
Sequences flagged as poor quality0
Sequence length12-29
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACCGTACGATCTCGTATGC367935244.78141905909109TruSeq Adapter, Index 22 (96% over 29bp)
TTCAAGTAATCCAGGATAGGCT2726853.318851052067933No Hit
TGAGGTAGTAGGTTGTATAGTT1152931.4032319135488502No Hit
TAGCTTATCAGACTGGTGTTGGC1099251.3378979478099917No Hit
TGGAGTGTGACAATGGTGTTTG1030181.2538328022514416No Hit
AAGCTGCCAGCTGAAGAACTGT956341.16396208633942No Hit
ATGACCTATGAATTGACAGCCA920761.1206576433254745No Hit
ATGACCTATGAATTGACAGCC903971.1002225225215359No Hit
TATTGCACTTGTCCCGGCCTGT878011.0686265882707762No Hit
AACATTCAACGCTGTCGGTGAGT773140.9409892375436133No Hit
AACATTCAACGCTGTCGGTGAG744820.9065209456336938No Hit
AACTCCAGTCACCGTACGATCTCGTAT571340.6953783156713765TruSeq Adapter, Index 22 (96% over 27bp)
TAACGGAACCCATAATGCAGCTG542860.6607152876489716No Hit
GTTCTACAGTCCGAC537530.654228140901801Illumina DpnII expression Adapter 1 (100% over 15bp)
TGGAGTGTGACAATGGTGTTTGT493920.6011503792424935No Hit
ACCACGTTCCCGTGG484470.5896487775988234No Hit
TGGAGTGTGACAATGGTGTTT465490.5665482062552404No Hit
TCAGTAACTGGAATCTGTCCCT455870.5548396974920545No Hit
TTCAAGTAATCCAGGATAGGTT440590.5362423987496968No Hit
CCTGTCTGAGGGTCGCT398460.4849659461308794No Hit
CTACAGTCCGACGATC397200.48343239924505677Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGAGAACTGAATTCCATAGATGG394190.4797689261289248No Hit
TGAGATGAAGCACTGTAGCTCT361100.4394950638655338No Hit
AGTTCTACAGTCCGACGATC340510.41443496039006616No Hit
CACCACGTTCCCGTGG293060.35668353203110864No Hit
TAGCTTATCAGACTGGTGTTGG291940.3553203792437107No Hit
TGAGATGAAGCACTGTAGCTC287090.34941744083399634No Hit
TAGTTCTACAGTCCGACGATC274600.3342158530531032Illumina DpnII expression Sequencing Primer (95% over 21bp)
TCTACAGTCCGACGATC271970.3310148782041241Illumina DpnII expression Sequencing Primer (100% over 17bp)
TTCCAGTGATGACAGCCTATAATCTGACT259310.3156063833037152No Hit
TGTAAACATCCTACACTCTCAGCT254630.30991035201351663No Hit
ACAGTCCGACGATC254210.30939916971824244Illumina DpnII expression Sequencing Primer (100% over 14bp)
TGTAAACATCCTTGACTGGAAGCT252400.30719621744575104No Hit
GGACAACTCTTAGCGG238340.29008378156109477No Hit
TGAGGTAGTAGTTTGTATAGTT233960.28475288048180636No Hit
TCCAGTGATGACAGCCTATAATCTGACT227520.2769147519542682No Hit
TAACACTGTCTGGTAACGATGT220010.2677743256744837No Hit
AACATTCAACGCTGTCGGTGA217560.26479242895205074No Hit
TGGACAACTCTTAGCGG214630.2612263238921615No Hit
TGAGGTAGTAGGTTGTATAGT211840.2578306129306969No Hit
CATTGCACTTGTCTCGGTCTGA208720.25403325873723126No Hit
TACAGTCCGACGATC207880.25301089414668276Illumina DpnII expression Sequencing Primer (100% over 15bp)
TTCTACAGTCCGACGATC206670.25153820229601176Illumina DpnII expression Sequencing Primer (100% over 18bp)
TTCACAGTGGCTAAGTTCTG197890.24085205812337435No Hit
TATTGCACTTGTCCCGGCCTGTT190300.2316142637873472No Hit
AGAGTTCTACAGTCCGACGATC182340.22192614219119752Illumina DpnII expression Sequencing Primer (100% over 22bp)
CAGAGTTCTACAGTCCGACGATC180160.21927286265858367Illumina DpnII expression Sequencing Primer (100% over 23bp)
TCAGTAACTGGAATCTGTCCCTG173950.2117146672927433No Hit
TGAGAACTGAATTCCATAGATG173120.21070447370922515No Hit
CATTATTACTTTTGGTACGCG170360.20734527576885164No Hit
GTTCTACAGTCCGACG169010.20570218981975588Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGAGGTAGTAGGTTGTATAGTTT166000.20203871670362392No Hit
TATTGCACTTGTCCCGGCCTGTA164420.20011569759283038No Hit
TAACACTGTCTGGTAACGATG153460.1867762738875791No Hit
TCGTACCGTGAGTAATAATGC150030.1826016184761729No Hit
TGTAACAGCAACTCCATGTGGA148160.18032564016149952No Hit
TATTGCACTTGTCCCGGCCTGTAT147920.1800335359927714No Hit
TTCACAGTGGCTAAGTTCTGC147120.1790598554303443No Hit
TTCAAGTAATCCAGGATAGG146810.17868255421240378No Hit
TAGCAGCACGTAAATATTGGAG140030.17043061144583407No Hit
TTCAAGTAATCCAGGATAGGCTT138340.16837371125770684No Hit
ACAGTAGTCTGCACATTGGTT137710.1676069378147955No Hit
TACCCTGTAGATCCGGATTTGT137470.16731483364606736No Hit
TCGTACCGTGAGTAATAATGCA134260.1634079403893286No Hit
TTCAAGTAATCCAGGATAGGC133370.16232472076362844No Hit
TGAGATGAAGCACTGTAGCT131840.16046255668798662No Hit
TGTAAACATCCTACACTCAGCT130420.15873427368967852No Hit
TACCCTGTAGAACCGAATTTGCG124660.15172377364020337No Hit
AACTCCAGTCAACGTACGATCTCGTATGC124190.15115173630977746RNA PCR Primer, Index 22 (96% over 29bp)
TTCACAGTGGTTAAGTTCTG115570.1406603282496254No Hit
TATTGCACTTGTCCCGGCCTGTTT114260.13906592632865103No Hit
TGAGGTAGTAGATTGAATAGTT110160.1340758134462121No Hit
TGAGGTAGTAGGTTGTGTGGTT109710.13352811812984686No Hit
CTGGACAACTCTTAGCGG103370.12581169967261208No Hit
TACCCTGTAGATCCGGATTTGTG99650.12128408505732605No Hit
CTACGCCTGTCTGAGGGTCGCT96560.11752324388495136No Hit
TATTGCACTTGTCCCGGCCTGTAA94270.11473608327500379No Hit
AACTCCAGTCACAGTACGATCTCGTATGC94130.11456568917657904RNA PCR Primer, Index 22 (96% over 29bp)
TCGTACCGTGAGTAATAATG93980.11438312407112397No Hit
TGTAAACATCCCCGACTGGAAGC93850.11422490097972955No Hit
TACCCTGTAGAACCGAATTTGC92100.11209497474942026No Hit
TGTAAACATCCCCGACTGGAAGCT90120.10968511535741317No Hit
ACTCCAGTCACCGTACGATCTCGTATGCC89960.10949037924492776TruSeq Adapter, Index 22 (96% over 29bp)
CTGTCTGAGGGTCGCT89580.10902788097777488No Hit
AACTCCAGTCACCGTACGATCTCGTATG86440.1052061847702485TruSeq Adapter, Index 22 (96% over 28bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AGTATGC555.456968E-1239.7491523
TAACTAA258.092618E-539.74914623
CGTATGC3827200.039.42770423
TTCTGGC259.451371E-538.71560322
TCGTATG3846500.038.329122
TGGCATT307.3357733E-637.6835121
ATAACTA3750.037.6831922
CTCGTAT3903750.037.32055321
CAAAATA251.18218944E-437.27160620
CGTCTTC1400.037.27160620
TATCGTA1750.037.27160620
TCTCGTA3906600.036.9319620
CTTCTTG200.00188256936.83820719
TAGATGC900.036.83820719
ATTTCGT1100.036.83820719
ACAAAAT251.2664258E-436.83820319
GACAACC6850.036.58326321
ACAACCC4400.036.5158522
ATCTCGT3907750.036.5007219
AGACAAC7450.036.27102720