FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_39_JM13_3_GAGTGG_L007_R1_001_TRIMMED_prinseq_good_TmAQ.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_39_JM13_3_GAGTGG_L007_R1_001_TRIMMED_prinseq_good_TmAQ.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8567777
Sequences flagged as poor quality0
Sequence length12-29
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACGAGTGGATCTCGTATGC451624952.712027869072685RNA PCR Primer, Index 23 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCT1381851.6128454323682793No Hit
AACTCCAGTCACGAGTGGATCTCGTAT1107721.292890793026009RNA PCR Primer, Index 23 (100% over 27bp)
TCAGTAACTGGAATCTGTCCCT973561.1363040844783892No Hit
ATGACCTATGAATTGACAGCCA936381.092908930752983No Hit
TGAGGTAGTAGGTTGTATAGTT913771.0665193550205614No Hit
ATGACCTATGAATTGACAGCC909981.0620958038473691No Hit
TGGAGTGTGACAATGGTGTTTG817600.9542732029556791No Hit
TAGCTTATCAGACTGGTGTTGGC536150.6257749238804885No Hit
CCTGTCTGAGGGTCGCT533060.6221683874358541No Hit
TATTGCACTTGTCCCGGCCTGT518070.6046726006057347No Hit
AAGCTGCCAGCTGAAGAACTGT512190.597809676885848No Hit
TGGAGTGTGACAATGGTGTTT427370.4988108350625839No Hit
AACTCCAGTCACGAGCGGATCTCGTATGC419330.48942683732314696RNA PCR Primer, Index 23 (96% over 29bp)
AACTCCAGTCACGAGGGGATCTCGTATGC372450.4347101937877235RNA PCR Primer, Index 23 (96% over 29bp)
TCAGTAACTGGAATCTGTCCCTG342160.3993567993191232No Hit
TGGAGTGTGACAATGGTGTTTGT341860.39900665014974124No Hit
ACCACGTTCCCGTGG307550.3589612568114226No Hit
TTCAAGTAATCCAGGATAGGTT293820.3429360964927075No Hit
AACATTCAACGCTGTCGGTGAG281370.3284049059633555No Hit
AACATTCAACGCTGTCGGTGAGT274470.32035147506757No Hit
GTTCTACAGTCCGAC267710.3124614471174962Illumina DpnII expression Adapter 1 (100% over 15bp)
TGTAAACATCCTTGACTGGAAGCT219600.2563091919876066No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT210840.2460848362416529No Hit
TGAGGTAGTAGTTTGTATAGTT208670.24355209058312324No Hit
TAACGGAACCCATAATGCAGCTG203070.2370159727546597No Hit
GGACAACTCTTAGCGG202920.2368408981699687No Hit
CTACAGTCCGACGATC199990.23342110794900475Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGTAAACATCCTACACTCTCAGCT196940.22986125806028798No Hit
CACCACGTTCCCGTGG192730.2249474980499609No Hit
TGGACAACTCTTAGCGG181810.212202068284457No Hit
AACTCCAGTCACGAGTGGATCT173960.2030398316856286RNA PCR Primer, Index 23 (100% over 22bp)
TGAGATGAAGCACTGTAGCTC171400.2000518921069024No Hit
TGAGATGAAGCACTGTAGCTCT169250.19754248972633157No Hit
TTCCAGTGATGACAGCCTATAATCTGACT155060.1809804340145641No Hit
TCAGTAACTGGAATCTGTCCCTGC146440.170919481214322No Hit
CATTATTACTTTTGGTACGCG143600.16760473574417262No Hit
TGAGAACTGAATTCCATAGATGG141100.1646868259993228No Hit
TAGCTTATCAGACTGGTGTTGG136850.15972637943307816No Hit
TCTACAGTCCGACGATC136150.15890936470452022Illumina DpnII expression Sequencing Primer (100% over 17bp)
AACTCCAGTCACGAGTGGATCTCGTATG135950.1586759319249322RNA PCR Primer, Index 23 (100% over 28bp)
AGTTCTACAGTCCGACGATC135150.15774220080658027No Hit
TCCAGTGATGACAGCCTATAATCTGACT132360.1544858135313279No Hit
ACAGTCCGACGATC129120.15070420250200256Illumina DpnII expression Sequencing Primer (100% over 14bp)
AAATCCAGTCACGAGTGGATCTCGTATGC128190.14961874007691842RNA PCR Primer, Index 23 (96% over 29bp)
TGAGGTAGTAGGTTGTATAGT125920.1469692780285948No Hit
CTGTCTGAGGGTCGCT120190.14028142889339906No Hit
TGAGGTAGTAGGTTGTATAGTTT120120.14019972742054326No Hit
TATTGCACTTGTCCCGGCCTGTT117010.13656984769795014No Hit
TGTAAACATCCTACACTCAGCT116670.13617301197265055No Hit
TGTCTGAGGGTCGCT115450.13474907201716385No Hit
TACAGTCCGACGATC109850.1282129541887003Illumina DpnII expression Sequencing Primer (100% over 15bp)
AACTCCAGTCACGAGTGGATCTC108580.12673065603831657RNA PCR Primer, Index 23 (100% over 23bp)
CTACGCCTGTCTGAGGGTCGCT106560.12437298496447795No Hit
AACTCCAGTCACGTGGGGATCTCGTATGC104020.12140838866371055No Hit
TTCAAGTAATCCAGGATAGG103530.12083647835372No Hit
AACTCCAGTCACGAGTGGATCTCGTA102100.11916743397966591RNA PCR Primer, Index 23 (100% over 26bp)
TTCTACAGTCCGACGATC96390.11250292812242896Illumina DpnII expression Sequencing Primer (100% over 18bp)
CATTGCACTTGTCTCGGTCTGA95650.11163922683795342No Hit
TTCACAGTGGCTAAGTTCTG95620.11160421192101522No Hit
ACTCCAGTCACGAGTGGATCTCGTATGCC94170.10991182426900233RNA PCR Primer, Index 23 (100% over 29bp)
ACAGTAGTCTGCACATTGGTT93030.10858125742535082No Hit
TAACACTGTCTGGTAACGATGT89980.10502140753663405No Hit
TGTAACAGCAACTCCATGTGGA88120.10285048268646581No Hit
TAGTTCTACAGTCCGACGATC87530.10216185598668126Illumina DpnII expression Sequencing Primer (95% over 21bp)
TGAGGTAGTAGATTGAATAGTT87200.1017766919003611No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CATATGC301.4389438E-534.15572723
AGTATGC1000.034.15572723
CGTAAGC650.034.15572723
CATGCCG200.002728067334.15572423
CGTATGC4788900.033.5120423
ACACCTT252.2600578E-433.3816322
ATAACTA1500.033.38162622
TCATATG301.683426E-533.38162622
CGTAGGC6950.032.68137723
TCGTATG4826700.032.62397422
CGTGTGC1050.032.52926323
ACAACCC8050.032.3449322
CAACCCG3750.032.33408723
CTAGTAT1050.032.1128821
CTCATAT302.1943364E-532.1128821
TCGTAGG6900.031.93025422
TAGTATG1150.031.9302522
TATCGTA1600.031.61053820
TAACTGC657.2759576E-1231.52836423
CTCGTAT4925000.031.52050421