FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_39_JM15_3_GGTAGC_L006_R1_001_TRIMMED_prinseq_good_ugU0.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_39_JM15_3_GGTAGC_L006_R1_001_TRIMMED_prinseq_good_ugU0.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8672903
Sequences flagged as poor quality0
Sequence length12-29
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACGGTAGCATCTCGTATGC447632751.61278755221868RNA PCR Primer, Index 24 (100% over 29bp)
ATGACCTATGAATTGACAGCCA2700273.113455782913749No Hit
ATGACCTATGAATTGACAGCC2651173.056842674246443No Hit
TTCAAGTAATCCAGGATAGGCT1635581.8858506776796653No Hit
TAGCTTATCAGACTGGTGTTGGC1204901.3892695444651No Hit
TGAGGTAGTAGGTTGTATAGTT966021.1138369701586655No Hit
AACTCCAGTCACGGTAGCATCTCGTAT800050.9224708266655353RNA PCR Primer, Index 24 (100% over 27bp)
TGGAGTGTGACAATGGTGTTTG746470.8606922042135142No Hit
TGAGAACTGAATTCCATAGATGG644590.7432228862700297No Hit
TAACGGAACCCATAATGCAGCTG634900.732050156677643No Hit
AAGCTGCCAGCTGAAGAACTGT572570.6601826401148496No Hit
TATTGCACTTGTCCCGGCCTGT547380.6311381552405233No Hit
AACATTCAACGCTGTCGGTGAGT532370.613831378028787No Hit
AACATTCAACGCTGTCGGTGAG507040.5846254708486881No Hit
TGAGATGAAGCACTGTAGCTCT489230.5640902475215046No Hit
CCTGTCTGAGGGTCGCT447760.5162746545187926No Hit
TGAGATGAAGCACTGTAGCTC375350.43278473194038947No Hit
TAGCTTATCAGACTGGTGTTGG344400.3970988722000004No Hit
TGGAGTGTGACAATGGTGTTTGT324190.37379640934529074No Hit
TTCAAGTAATCCAGGATAGGTT316500.36492971269250907No Hit
TGTAACAGCAACTCCATGTGGA311520.3591876906728923No Hit
ACCACGTTCCCGTGG300300.3462508458817077No Hit
TGAGAACTGAATTCCATAGATG285590.32928997361091206No Hit
TGTAAACATCCTTGACTGGAAGCT284850.3284367414232582No Hit
TGGAGTGTGACAATGGTGTTT271740.31332069550414665No Hit
GTTCTACAGTCCGAC266510.3072904193670793Illumina DpnII expression Adapter 1 (100% over 15bp)
TCAGTAACTGGAATCTGTCCCT226690.2613773035395415No Hit
TTCCAGTGATGACAGCCTATAATCTGACT209610.2416837822353138No Hit
TGTAAACATCCTACACTCTCAGCT206490.23808637084952985No Hit
TTCACAGTGGTTAAGTTCTG185020.21333110724286894No Hit
CTACAGTCCGACGATC183220.21125567759722438Illumina DpnII expression Sequencing Primer (100% over 16bp)
CACCACGTTCCCGTGG181950.2097913466805751No Hit
AACTCCAGTCACGGTAGAATCTCGTATGC180470.20808488230526734RNA PCR Primer, Index 24 (96% over 29bp)
TAACACTGTCTGGTAACGATGT175940.20286171769706177No Hit
TGAGGTAGTAGTTTGTATAGTT175220.20203154583880392No Hit
TCCAGTGATGACAGCCTATAATCTGACT168710.19452540862038928No Hit
GGACAACTCTTAGCGG163070.18802239573070287No Hit
TGAGGTAGTAGGTTGTATAGT155790.17962843583054025No Hit
AACTCCAGTGACGGTAGCATCTCGTATGC155050.17877520364288635RNA PCR Primer, Index 24 (96% over 29bp)
TGAGATGAAGCACTGTAGCT154070.17764524750247984No Hit
CATTATTACTTTTGGTACGCG152880.1762731579034148No Hit
TTCACAGTGGCTAAGTTCTG151600.17479729682206752No Hit
ATGACCTATGAATTGACAGCCAT146990.16948189089627774No Hit
AACTCCAGTCACGGTAGCATCTCGTATG146180.16854794755573768RNA PCR Primer, Index 24 (100% over 28bp)
AGTTCTACAGTCCGACGATC141970.16369374821786892No Hit
TGAGGTAGTAGGTTGTATAGTTT136320.1571792051634845No Hit
AACTCCAGTCACGGTAGGATCTCGTATGC133970.15446961645944846RNA PCR Primer, Index 24 (96% over 29bp)
TATTGCACTTGTCCCGGCCTGTT133490.15391616855394324No Hit
AACTCCAGTCACGGTAGCATCT133020.15337425081313605RNA PCR Primer, Index 24 (100% over 22bp)
TCTACAGTCCGACGATC128730.14842781015768308Illumina DpnII expression Sequencing Primer (100% over 17bp)
ATGACCTATGAATTGACAGCCT127460.14696347924103384No Hit
ACAGTCCGACGATC124700.14378115378437878Illumina DpnII expression Sequencing Primer (100% over 14bp)
AAATCCAGTCACGGTAGCATCTCGTATGC123180.1420285687502789RNA PCR Primer, Index 24 (96% over 29bp)
TGGACAACTCTTAGCGG121800.14043740602195134No Hit
TGAGGTAGTAGATTGAATAGTT118680.1368399946361674No Hit
ATGACCTATGAATTGACAGC118190.1362750165659641No Hit
CATTGCACTTGTCTCGGTCTGA115270.13290820847414067No Hit
TTCAAGTAATCCAGGATAGG112970.1302562705935948No Hit
TAACACTGTCTGGTAACGATG112720.12996801647614414No Hit
TAGCAGCACGTAAATATTGGAG111860.12897642231211395No Hit
TGTAAACATCCTACACTCAGCT110710.127650453371841No Hit
TCGTACCGTGAGTAATAATGC110620.12754668188955876No Hit
AACATTCAACGCTGTCGGTGA107330.12375325770390838No Hit
CTACGCCTGTCTGAGGGTCGCT105240.12134345328202102No Hit
TACAGTCCGACGATC105000.12106672932926842Illumina DpnII expression Sequencing Primer (100% over 15bp)
CTGTCTGAGGGTCGCT104200.12014431615342636No Hit
TTCACAGTGGCTAAGTTCTGC103380.11919884264818828No Hit
TTCACAGTGGTTAAGTTCTGCC102740.11846091210751464No Hit
AACTCCAGTCACGGTAGCATCTC98220.11324927766400708RNA PCR Primer, Index 24 (100% over 23bp)
TCGTACCGTGAGTAATAATGCA97750.11270735992319988No Hit
AACTCCAGTCACGGTTGCATCTCGTATGC95500.11011307286614413RNA PCR Primer, Index 24 (96% over 29bp)
AACTCCAGTCACGGGAGCATCTCGTATGC93710.10804917338519755RNA PCR Primer, Index 24 (96% over 29bp)
ACAGTAGTCTGCACATTGGTT93540.1078531605853311No Hit
TGTCTGAGGGTCGCT93490.10779550976184099No Hit
TAGTTCTACAGTCCGACGATC93080.10732277300922195Illumina DpnII expression Sequencing Primer (95% over 21bp)
TTCTACAGTCCGACGATC92990.10721900152693971Illumina DpnII expression Sequencing Primer (100% over 18bp)
TGTAACAGCAACTCCATGTGGAA90070.10385219343511626No Hit
ACTCCAGTCACGGTAGCATCTCGTATGCC88640.1022033798832986RNA PCR Primer, Index 24 (100% over 29bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTACGC552.1827873E-1135.3709123
GCATACC200.002503626334.75900322
CGTATGC4714900.034.7583823
TCGTATG4753700.034.01683422
CGTAGGC3750.033.95607823
CTAGTAT553.45608E-1133.90013521
GATAACA456.168193E-933.9001321
CGCATAC200.002830433.9001321
CGCGTAT456.168193E-933.9001321
TCGCATA408.943243E-833.60712420
TCTTCGT1800.033.60712420
CGTGTGC1800.033.4058623
CGTAAGC900.033.4058623
CCCTGCA252.270858E-433.35454619
ACAAAAT252.270858E-433.35454619
GCGATCA409.556061E-833.35454619
CTTCTTG301.6928048E-533.35454619
CTCGTAT4819250.033.28357321
GACAACC4950.033.21528221
TCTCGTA4819400.033.09005720