FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_39_JM18_3_ACTGAT_L008_R1_001_TRIMMED_prinseq_good_Y0sC.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_39_JM18_3_ACTGAT_L008_R1_001_TRIMMED_prinseq_good_Y0sC.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8823320
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT4998945.665599796901846No Hit
ATGACCTATGAATTGACAGCC4284804.856221921000258No Hit
CCTGTCTGAGGGTCGCT4056314.597260441647815No Hit
ATGACCTATGAATTGACAGCCA4040254.579058676325918No Hit
TGAGGTAGTAGGTTGTATAGTT3532654.003765022689872No Hit
TATTGCACTTGTCCCGGCCTGT1725251.9553297398258254No Hit
TCAGTAACTGGAATCTGTCCCT1629271.846549824782508No Hit
TAGCTTATCAGACTGGTGTTGGC1613861.8290847436112485No Hit
CTACGCCTGTCTGAGGGTCGCT1393391.579212813317436No Hit
AAGCTGCCAGCTGAAGAACTGT1297601.4706482367181515No Hit
AACATTCAACGCTGTCGGTGAG1206771.3677051268683442No Hit
AACATTCAACGCTGTCGGTGAGT1165161.3205460076252478No Hit
CTGTCTGAGGGTCGCT933881.0584224532262232No Hit
TGAGGTAGTAGTTTGTATAGTT926061.049559576213942No Hit
CTGGACAACTCTTAGCGG889821.0084866014153402No Hit
GGACAACTCTTAGCGG864550.9798465883590304No Hit
TAACGGAACCCATAATGCAGCTG780720.8848370001314698No Hit
TTCCAGTGATGACAGCCTATAATCTGACT697030.789986082336354No Hit
TGTCTGAGGGTCGCT663650.7521545178005559No Hit
TGTAAACATCCTTGACTGGAAGCT634040.7185957213384531No Hit
TCCAGTGATGACAGCCTATAATCTGACT572900.6493020767692886No Hit
ACTGGACAACTCTTAGCGG565820.6412778863285021No Hit
TTCAAGTAATCCAGGATAGGTT532110.6030723129162265No Hit
TGTAAACATCCTACACTCTCAGCT528470.5989468816726583No Hit
TGAGATGAAGCACTGTAGCTC513180.5816178037292086No Hit
CCACGTTCCCGTGG493630.5594606111985058No Hit
TGAGGTAGTAGGTTGTATAGT488780.5539638140745207No Hit
TGAGGTAGTAGGTTGTATAGTTT452170.5124714959901715No Hit
AACTGGACAACTCTTAGCGG441150.49998186623629204No Hit
TGGAGTGTGACAATGGTGTTTG434430.4923656854789354No Hit
CCTGTCTGAGGGTCGCTT427110.484069488582529No Hit
TTCACAGTGGCTAAGTTCTG426480.48335547163652687No Hit
AACTCCAGTCACACTGATATCT424610.48123608800315526TruSeq Adapter, Index 25 (100% over 22bp)
TGAGGTAGTAGATTGAATAGTT422400.4787313618909889No Hit
TGAGATGAAGCACTGTAGCTCT413030.46811177651949604No Hit
TATTGCACTTGTCCCGGCCTGTT386990.438599076084739No Hit
TACCCTGTAGATCCGGATTTGT383650.4348136529106958No Hit
TACGCCTGTCTGAGGGTCGCT359560.4075110049278503No Hit
TCGTACCGTGAGTAATAATGCA356350.40387291858393437No Hit
TTCACAGTGGCTAAGTTCTGC351320.39817211661823443No Hit
TTCACAGTGGTTAAGTTCTG347950.3943526926372386No Hit
CATTGCACTTGTCTCGGTCTGA347590.39394468295380874No Hit
TATTGCACTTGTCCCGGCCTGTA333160.3775902948096635No Hit
ACAGTAGTCTGCACATTGGTT333010.377420290774901No Hit
AACCCGTAGATCCGAACTTGTG303750.34425817039391066No Hit
TTCAAGTAATCCAGGATAGGC303190.34362348866413095No Hit
TCGTACCGTGAGTAATAATGC287710.3260790722766487No Hit
CATTATTACTTTTGGTACGCG280310.3176922065617024No Hit
TATTGCACTTGTCCCGGCCTGTAT268930.30479456712439307No Hit
TCAGTAACTGGAATCTGTCCCTGC245390.2781152672690098No Hit
TAGCTTATCAGACTGGTGTTGG241700.2739331680138542No Hit
AACTCCAGTCACACTGATATCTCGTATGC238790.27063508973946315TruSeq Adapter, Index 25 (100% over 29bp)
ATGACCTATGAATTGACAGCCAT235900.2673596786697071No Hit
AACATTCAACGCTGTCGGTGA232410.26340425146090135No Hit
TGAGGTAGTAGTTTGTGCTGTT229890.2605481836768926No Hit
TTCAAGTAATCCAGGATAGGCTT228430.2588934777385383No Hit
TCAGTAACTGGAATCTGTCCCTG226440.25663809087735684No Hit
AACTCCAGTCACACTGATATCTC221640.25119796176495923TruSeq Adapter, Index 25 (100% over 23bp)
TATTGCACTTGTCCCGGCCTGTTT210130.23815298549752245No Hit
TGAGATGAAGCACTGTAGCT203860.23104681684445308No Hit
TGTAAACATCCCCGACTGGAAGCT200200.22689871839624995No Hit
AACTCCAGTCACACTGATATCTCG199010.225550019720468TruSeq Adapter, Index 25 (100% over 24bp)
TCCCATATGGTCTAGCGGTTAGGATTCCT197750.22412198582846365No Hit
TGGACAACTCTTAGCGG189010.21421641740297306No Hit
TACCCTGTAGATCCGGATTTGTG187330.2123123722136339No Hit
ATGACCTATGAATTGACAGC186500.2113716832212818No Hit
TGTAAACATCCTACACTCAGCT186100.210918339128582No Hit
TACCCTGTAGAACCGAATTTGCG179280.2031888223480504No Hit
AACTCCAGTCACAGTGATCTCGTATGCCG176960.20055942661039156No Hit
GGAATACCAGGTGCTGTAAGCTT173340.19645666257145836No Hit
TATTGCACTTGTCCCGGCCTGTAA166460.18865914417702181No Hit
TGAGGTAGTAGGTTGTGTGGTT164160.18605241564399796No Hit
AACTCCAGTCACACTGATATCTCGTAT161850.1834343535086566TruSeq Adapter, Index 25 (100% over 27bp)
TCACAGTGAACCGGTCTCTTT160400.18179098117261983No Hit
AAGCTGCCAGCTGAAGAACT156690.17758621471282918No Hit
GAAGGATCATTA153410.17386879315269083No Hit
TACCCTGTAGAACCGAATTTGT144190.16341921181596042No Hit
TGGAGTGTGACAATGGTGTTT142330.16131116178490634No Hit
TGGAGTGTGACAATGGTGTTTGT141840.1607558152713491No Hit
AACAGTAAGAGTTTATGTGCTG141790.16069914725976164No Hit
TACAGTACTGTGATAACTGAAG139750.15838709238699267No Hit
TTCACAGTGGTTAAGTTCTGC134780.15275429203519764No Hit
GAATACCAGGTGCTGTAAGCTT132460.1501248962975388No Hit
TGTAACAGCAACTCCATGTGGA131080.1485608591777245No Hit
TGTAAACATCCCCGACTGGA130880.14833418713137458No Hit
AGCTACATCTGGCTACTGGGTCTC126010.14281472280275453No Hit
CGCCTGTCTGAGGGTCGCT124810.14145469052465512No Hit
TGTAAACATCCCCGACTGGAAGC124290.14086534320414537No Hit
CTACGCCTGTCTGAGGGTCGCTT122960.13935797409591855No Hit
TACCCTGTAGAACCGAATTTGC118750.13458652752025316No Hit
TGTAAACATCCTTGACTGGAAGC118180.13394051218815595No Hit
TGAGAACTGAATTCCATAGATGG117970.13370250653948854No Hit
ATGACCTATGAATTGACAGCCT115280.13065376751608238No Hit
AATGACACGTTTTCTCCCGGATT112480.12748035886718379No Hit
ACAGTAGTCTGCACATTGGTTA110970.12576898491724203No Hit
TTCACAGTGGCTAAGTTCTGCT110110.12479429511793745No Hit
TAATGTTTTCTGAGC106670.12089553592071918No Hit
TTCAAGTAATCCAGGATAGGCA105450.11951283643798478No Hit
GTTGTCGTGGCCGA102500.11616942375432376No Hit
TGTAAACATCCTACACTCTCAGC102330.11597675251492637No Hit
TACGACCTCAGATCAGACGAGA102180.11580674848016392No Hit
CTCGTACCGTGAGTAATAATGC101080.11456005222523949No Hit
CTGTCTGAGGGTCGCTT96320.10916525752211186No Hit
TGCCTGTGATGAGACTCTCGACG95080.10775989083474248No Hit
CTTCATGATGATCTCAAGAGTTCTGACA94600.1072158779235027No Hit
TGAGGTAGTTGGTTGTATTGTT93720.10621852091956316No Hit
TGAGGTAGTTGTTTGTACAGTT91770.10400846846765163No Hit
TGAGGTAGTAGTTTGTATAGT90210.1022404265061224No Hit
GTCTGAGGGTCGCT89720.10168507999256517No Hit
TTCACAGTGGTTAAGTTCTGCC89280.10118640149059538No Hit
TCGTACCGTGAGTAATAATG88730.10056305336313316No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCACCCG102.0055978E-4476.987323
CAACCCG1150.0435.5101623
TAACTGC2400.0427.3011523
TATGCCG38450.0426.7454823
ACATAGC400.0417.363923
GCTTCCT2600.0403.6046423
GATTCCT24500.0395.2180823
AATAACC1850.0386.7464623
TAACTAA500.0381.5898423
AAATAGC7700.0303.5373823
ACACCTT350.0285.6892422
AACATAG350.0285.6892422
TTCGCGG109.316665E-4285.6892422
CATAGCT2100.0283.9210223
ATAACTA4700.0276.5715322
ATGCCGT5500.0273.1836523
ACAACCC7750.0269.1008622
GGCTTCG400.0249.9780722
GGATTCC28300.0244.8043822
TCGGATA301.6902888E-5238.4936723