FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_39_JM1_3_GTTTCG_L004_R1_001_TRIMMED_prinseq_good_e40z.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_39_JM1_3_GTTTCG_L004_R1_001_TRIMMED_prinseq_good_e40z.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10570854
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACGTTTCGATCTCGTATGC456597543.194003057841876TruSeq Adapter, Index 21 (96% over 29bp)
ATGACCTATGAATTGACAGCCA7227666.837347294740804No Hit
ATGACCTATGAATTGACAGCC6209085.873773301570526No Hit
TGAGATGAAGCACTGTAGCTCT2120472.00595902658385No Hit
TGTAACAGCAACTCCATGTGGA1530391.4477449031081122No Hit
TTCAAGTAATCCAGGATAGGCT1525971.4435635947672725No Hit
TGAGATGAAGCACTGTAGCTC1387831.3128835191555952No Hit
TGAGGTAGTAGGTTGTATAGTT1046230.9897308202345809No Hit
TAGCTTATCAGACTGGTGTTGGC901560.852873381847862No Hit
AAGCTGCCAGCTGAAGAACTGT680710.6439498644101981No Hit
TATTGCACTTGTCCCGGCCTGT625490.5917118900705658No Hit
TCAGTAACTGGAATCTGTCCCT595570.5634076489941116No Hit
TGGAGTGTGACAATGGTGTTTG535440.5065248276061707No Hit
GTTCTACAGTCCGAC530200.5015678014283426Illumina DpnII expression Adapter 1 (100% over 15bp)
AACATTCAACGCTGTCGGTGAGT498680.4717499645723988No Hit
AACATTCAACGCTGTCGGTGAG496150.4693565912460809No Hit
TGAGATGAAGCACTGTAGCT469760.4443917208581256No Hit
TAACGGAACCCATAATGCAGCTG426700.4036570744426136No Hit
ACCACGTTCCCGTGG405430.3835357105490247No Hit
AACTCCAGTCACGTTTCGATCTCGTAT381820.3612007128279323TruSeq Adapter, Index 21 (96% over 27bp)
CTACAGTCCGACGATC369650.34968792493019013Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGTAACAGCAACTCCATGTGGAA367350.34751213099717393No Hit
ATGACCTATGAATTGACAGCCT361700.3421672459008515No Hit
TAACACTGTCTGGTAACGATGT339620.32127962414389605No Hit
ATGACCTATGAATTGACAGCCAT297430.28136799543348157No Hit
TCAGTAACTGGAATCTGTCCCTG295770.27979763981226113No Hit
TGAGAACTGAATTCCATAGATGG293980.27810430453395724No Hit
TAGCTTATCAGACTGGTGTTGG282190.2669509956338438No Hit
CCTGTCTGAGGGTCGCT274660.2598276354966212No Hit
AGTTCTACAGTCCGACGATC274600.2597708756548903No Hit
TTCAAGTAATCCAGGATAGGTT271000.25636528515103885No Hit
TTCACAGTGGTTAAGTTCTG258730.24475789751707855No Hit
TTTGTTCGTTCGGCTCGCGTTA257290.243395661315538No Hit
ACAGTCCGACGATC252180.23856161479479332Illumina DpnII expression Sequencing Primer (100% over 14bp)
TCTACAGTCCGACGATC242530.22943274024974708Illumina DpnII expression Sequencing Primer (100% over 17bp)
ATGACCTATGAATTGACAGC233320.2207201045440605No Hit
CACCACGTTCCCGTGG232700.2201335861795083No Hit
TGAGGTAGTAGTTTGTATAGTT216500.20480842891217682No Hit
GTCCAGTTTTCCCAGGAATCCCT213340.201819077247685No Hit
TACAGTCCGACGATC206230.1950930360025784Illumina DpnII expression Sequencing Primer (100% over 15bp)
TAGTTCTACAGTCCGACGATC205040.19396729914158306Illumina DpnII expression Sequencing Primer (95% over 21bp)
TGAGGTAGTAGGTTGTATAGT204620.19356998024946706No Hit
TGGAGTGTGACAATGGTGTTT196300.18569928219612153No Hit
TGGAGTGTGACAATGGTGTTTGT191430.18109227504230027No Hit
GGACAACTCTTAGCGG191310.18097875535883856No Hit
TAACACTGTCTGGTAACGATG185410.1753973709219709No Hit
TCAGTAACAAGGATTCATCCTG184580.17461219311136073No Hit
AAATCCAGTCACGTTTCGATCTCGTATGC181960.17213368002244664RNA PCR Primer, Index 21 (96% over 29bp)
TGGACAACTCTTAGCGG178920.16925784804141653No Hit
CAGAGTTCTACAGTCCGACGATC177330.1677537122355488Illumina DpnII expression Sequencing Primer (100% over 23bp)
TTCTACAGTCCGACGATC175820.16632525621865557Illumina DpnII expression Sequencing Primer (100% over 18bp)
TGTAACAGCAACTCCATGTGG168340.159249195949542No Hit
TCAGTAACAAGGATTCATCCTGT162890.1540935103256558No Hit
CATTGCACTTGTCTCGGTCTGA160750.15206907597058855No Hit
TGTAAACATCCTACACTCTCAGCT159070.15047980040212458No Hit
TATTGCACTTGTCCCGGCCTGTT158280.1497324624860016No Hit
GTTCTACAGTCCGACG156050.1476228883683381Illumina DpnII expression Sequencing Primer (100% over 16bp)
AACTCCAGTCACGCTTCGATCTCGTATGC153820.14551331425067454RNA PCR Primer, Index 21 (96% over 29bp)
AGAGTTCTACAGTCCGACGATC146740.13881565292643339Illumina DpnII expression Sequencing Primer (100% over 22bp)
TTCACAGTGGCTAAGTTCTG146600.13868321329572805No Hit
TTTGTTCGTTCGGCTCGCGTT144530.13672499875601346No Hit
TAGCAGCACGTAAATATTGGAG140230.13265721009863538No Hit
AACATTCAACGCTGTCGGTGA139170.13165445289472355No Hit
TGTAAACATCCTTGACTGGAAGCT136480.12910971999045678No Hit
TGAGGTAGTAGGTTGTATAGTTT136300.1289394404652642No Hit
TGAGAACTGAATTCCATAGATG134750.12747314455388373No Hit
TTCACAGTGGTTAAGTTCTGCC131600.12449325286301371No Hit
AACTCCAGTCACGGTTCGATCTCGTATGC127380.12050114399461008RNA PCR Primer, Index 21 (96% over 29bp)
TGTAACAGCATCTCCATGTGGAA117670.11131550960783301No Hit
ACAGTAGTCTGCACATTGGTT112620.10653822292881919No Hit
TATTGCACTTGTCCCGGCCTGTA110840.10485434762413709No Hit
TTCCAGTGATGACAGCCTATAATCTGACT106320.10057843954707918No Hit
TGAGGTAGTAGGTTGTGTGGTT105850.10013382078685412No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAA304.040203E-641.1033523
CGTATGC4725850.040.77284623
ATATGAC200.001207002740.32612222
GCATGCC200.001207002740.32612222
TCGTATG4761700.039.81799322
TAACTGC1500.039.73324223
CGCGTAT305.2634114E-639.55106721
CTCGTAT4791250.039.09622621
ATAACTA2600.038.7751222
TCTCGTA4789250.038.73982620
ACAAAAT259.470612E-538.7024919
ACCTCGT501.10958354E-1038.7024919
GTTAGAA200.001477221738.70248819
ATATCGT3700.038.70248819
TATCGTA3750.038.6228920
CGTAGGC2350.038.47973323
ATCTCGT4788900.038.31213819
AATATCG251.16761985E-437.35045618
AACAAAA307.796858E-637.35045218
GATATCG3350.037.35045218