FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_5_JM100_3_ATCACG_L004_R1_001_TRIMMED_prinseq_good_KnR5.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_5_JM100_3_ATCACG_L004_R1_001_TRIMMED_prinseq_good_KnR5.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11358783
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACATCACGATCTCGTATGC603825553.159348144955324Illumina PCR Primer Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCC9093708.005875277307437No Hit
ATGACCTATGAATTGACAGCCA8865537.804999884230555No Hit
TAGCTTATCAGACTGGTGTTGGC1473001.2967938554684952No Hit
TGAGATGAAGCACTGTAGCTC1138721.002501764493608No Hit
TGTAACAGCAACTCCATGTGGA950530.8368238040994357No Hit
GTTCTACAGTCCGAC747690.6582483352309838Illumina DpnII expression Adapter 1 (100% over 15bp)
TGAGATGAAGCACTGTAGCTCT738440.650104857184084No Hit
AAGCTGCCAGCTGAAGAACTGT635280.5592852685010358No Hit
TTCAAGTAATCCAGGATAGGCT485990.42785393470409644No Hit
TGAGAACTGAATTCCATAGATGG446720.3932815689849872No Hit
TAACGGAACCCATAATGCAGCTG430930.3793804318649278No Hit
TATTGCACTTGTCCCGGCCTGT416110.3663332594697865No Hit
CTACAGTCCGACGATC416110.3663332594697865Illumina DpnII expression Sequencing Primer (100% over 16bp)
ACCACGTTCCCGTGG412290.3629702231304181No Hit
TGGAGTGTGACAATGGTGTTTG401660.3536118261965212No Hit
TGTAACAGCAACTCCATGTGGAA388150.341717946368022No Hit
AACATTCAACGCTGTCGGTGAGT382590.33682305577983135No Hit
GGACAACTCTTAGCGG374180.32941909357719046No Hit
TGGACAACTCTTAGCGG371930.3274382475657824No Hit
TGAGGTAGTAGGTTGTATAGTT363200.31975256504151894No Hit
AACTCCAGTCACATTACGATCTCGTATGC350470.30854537849697455Illumina PCR Primer Index 1 (96% over 29bp)
CCTGTCTGAGGGTCGCT334470.29445936241585036No Hit
AACATTCAACGCTGTCGGTGAG319900.28163228402197665No Hit
AGTTCTACAGTCCGACGATC317030.279105604887425No Hit
ATGACCTATGAATTGACAGCCAT311760.2744660233407047No Hit
TCTACAGTCCGACGATC298420.2627218074330674Illumina DpnII expression Sequencing Primer (100% over 17bp)
TGTAAACATCCTTGACTGGAAGCT295620.2602567546188707No Hit
CACCACGTTCCCGTGG286000.2517875374500948No Hit
ACAGTCCGACGATC268780.23662746264278486Illumina DpnII expression Sequencing Primer (100% over 14bp)
AACTCCAGTCACATAACGATCTCGTATGC251470.22138815399501865Illumina PCR Primer Index 1 (96% over 29bp)
ATGACCTATGAATTGACAGC237250.20886920720291952No Hit
CAGAGTTCTACAGTCCGACGATC225450.19848077034309045Illumina DpnII expression Sequencing Primer (100% over 23bp)
TTCTACAGTCCGACGATC216780.1908479103791313Illumina DpnII expression Sequencing Primer (100% over 18bp)
TACAGTCCGACGATC215610.1898178704531991Illumina DpnII expression Sequencing Primer (100% over 15bp)
ATGACCTATGAATTGACAGCCT214320.18868218540665846No Hit
TCAGTAACAAGGATTCATCCTGT212150.18677176947565596No Hit
TGTAAACATCCTACACTCTCAGCT202770.1785138425480969No Hit
TCAGTAACTGGAATCTGTCCCT188050.16555470775346268No Hit
ATGACCTATGAATTGACAGCCAG187830.16536102503234723No Hit
TAACACTGTCTGGTAACGATGT186670.16433978886646572No Hit
AAATCCAGTCACATCACGATCTCGTATGC186030.16377634822322074Illumina PCR Primer Index 1 (96% over 29bp)
TAGTTCTACAGTCCGACGATC184920.16279913085759273Illumina DpnII expression Sequencing Primer (95% over 21bp)
GTTCTACAGTCCGACG180850.15921600051695678Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGAGGTAGTAGTTTGTATAGTT179030.1576137161877289No Hit
TAGCTTATCAGACTGGTGTTGG175070.15412742720765069No Hit
TGAGATGAAGCACTGTAGCT164930.14520041451623825No Hit
AACTCCAGTCACGTTTCGATCTCGTATGC162980.14348368130635122TruSeq Adapter, Index 21 (96% over 29bp)
TTCACAGTGGTTAAGTTCTGCC160010.14086896457129255No Hit
AGAGTTCTACAGTCCGACGATC159880.1407545156906334Illumina DpnII expression Sequencing Primer (100% over 22bp)
TCAGTAACTGGAATCTGTCCCTG156800.138042957595017No Hit
TTCAAGTAATCCAGGATAGGTT151270.13317447828697845No Hit
ACTCCAGTCACATCACGATCTCGTATGCC150410.13241735492261802Illumina PCR Primer Index 1 (100% over 29bp)
CTGGACAACTCTTAGCGG145930.12847327041990325No Hit
TTCACAGTGGTTAAGTTCTG144320.12705586505174013No Hit
TCAGTAACAAGGATTCATCCTG139420.12274202262689586No Hit
TCAGTAACTGGAATCTGTCCCTGC137700.12122777589817502No Hit
TGGAGTGTGACAATGGTGTTT135570.11935257500737535No Hit
TGGAGTGTGACAATGGTGTTTGT135460.11925573364681762No Hit
TAGCAGCACGTAAATATTGGAG124480.10958920511114614No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGCACT251.9158641E-434.3341223
CCGGCTT200.002659330634.3341223
CGTACGC650.034.3341223
TAACTAA301.3885885E-534.3341223
TAGTATG950.034.1501322
GATAACA456.004484E-933.99402221
CTAGTAT900.033.99402221
CTCCGAT200.002852287133.84705420
TAGACGC301.5312882E-533.8470520
TCTTCGT2700.033.8470520
TCGCGTA456.2645995E-933.8470520
CGTATGC6390500.033.71035423
CCCTGCA1200.033.65449519
ACAAAAT200.00293317733.65449519
CACTGTT200.00293317733.65449519
CTCTCAT200.00293317733.65449519
TCGTATG6418350.033.38554822
CTCGTAT6392850.033.33837521
TCTCGTA6373100.033.29232820
ATCTCGT6364950.033.1336819