FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_5_JM101_3_CGATGT_L005_R1_001_TRIMMED_prinseq_good_YkGc.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_5_JM101_3_CGATGT_L005_R1_001_TRIMMED_prinseq_good_YkGc.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8876538
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACCGATGTATCTCGTATGC458015151.59839342770797Illumina PCR Primer Index 2 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTG2688963.0292891215020994No Hit
AAGCTGCCAGCTGAAGAACTGT1244661.4021908090744388No Hit
TTCAAGTAATCCAGGATAGGCT1162471.309598404242735No Hit
TGGAGTGTGACAATGGTGTTT1066371.2013354756099732No Hit
TAGCTTATCAGACTGGTGTTGGC1023001.1524763370584343No Hit
GTTCTACAGTCCGAC959011.0803874213122278Illumina DpnII expression Adapter 1 (100% over 15bp)
ACCACGTTCCCGTGG879460.9907691489632556No Hit
ATGACCTATGAATTGACAGCCA823020.9271858014915275No Hit
TGGAGTGTGACAATGGTGTTTGT770890.8684579506109251No Hit
AACATTCAACGCTGTCGGTGAGT769870.8673088539698698No Hit
ATGACCTATGAATTGACAGCC767480.8646163628207304No Hit
AACATTCAACGCTGTCGGTGAG662560.7464171279388429No Hit
TATTGCACTTGTCCCGGCCTGT640690.7217791440762152No Hit
CTACAGTCCGACGATC627490.7069084816625582Illumina DpnII expression Sequencing Primer (100% over 16bp)
CACCACGTTCCCGTGG585500.659604003272447No Hit
TGAGGTAGTAGGTTGTATAGTT573370.6459387657665635No Hit
AGTTCTACAGTCCGACGATC565370.6369262430916197No Hit
CCTGTCTGAGGGTCGCT493570.5560388520839994No Hit
TCTACAGTCCGACGATC451740.5089146241473872Illumina DpnII expression Sequencing Primer (100% over 17bp)
TAGTTCTACAGTCCGACGATC425770.47965772241385096Illumina DpnII expression Sequencing Primer (95% over 21bp)
AACTCCAGTCACCGATGGATCTCGTATGC392090.44171500195233776Illumina PCR Primer Index 2 (96% over 29bp)
TGGACAACTCTTAGCGG383090.43157591394302597No Hit
ACAGTCCGACGATC375720.423273127428734Illumina DpnII expression Sequencing Primer (100% over 14bp)
TTCAAGTAATCCAGGATAGGTT344690.3883158051032959No Hit
TGTAAACATCCTTGACTGGAAGCT343440.38690759843533595No Hit
TGTAAACATCCTACACTCTCAGCT335630.3781091231739221No Hit
CAGAGTTCTACAGTCCGACGATC335560.37803026360051634Illumina DpnII expression Sequencing Primer (100% over 23bp)
TTCTACAGTCCGACGATC332140.37417741015697786Illumina DpnII expression Sequencing Primer (100% over 18bp)
AGAGTTCTACAGTCCGACGATC327770.36925431964578986Illumina DpnII expression Sequencing Primer (100% over 22bp)
TACAGTCCGACGATC324700.36579576406928016Illumina DpnII expression Sequencing Primer (100% over 15bp)
GGACAACTCTTAGCGG318350.35864207419604355No Hit
TGAGGTAGTAGTTTGTATAGTT317300.3574591805949572No Hit
TAACGGAACCCATAATGCAGCTG310280.349550691947694No Hit
GTTCTACAGTCCGACG290770.3275714022741749Illumina DpnII expression Sequencing Primer (100% over 16bp)
TAGCAGCACGTAAATATTGGAG266690.30044370902259415No Hit
TGAGAACTGAATTCCATAGATGG216460.24385633227729098No Hit
GCATCGATGGTTCAGTGGTAGAATGC205710.2317457549328353No Hit
TAGCTTATCAGACTGGTGTTGG186490.21009316920628288No Hit
CTGGACAACTCTTAGCGG166590.18767451905236027No Hit
AACTCCAGTCACCGTTGTATCTCGTATGC164690.18553404491706113Illumina PCR Primer Index 2 (96% over 29bp)
TGAGGTAGTAGATTGAATAGTT156210.17598077088162076No Hit
AACATTCAACGCTGTCGGTGA149120.16799342266095182No Hit
TGAGGTAGTAGTTTGTGCTGTT147730.16642749684618036No Hit
TTCACAGTGGTTAAGTTCTGCC142860.16094112366780833No Hit
GCATCGATGGTTCAGTGGTAGAATGCTC138160.15564626659627886No Hit
TGAGATGAAGCACTGTAGCTC137050.1543957790751304No Hit
TGTCTGAGGGTCGCT135350.15248061800670487No Hit
TCACAGTGAACCGGTCTCTTT133940.15089216088524604No Hit
CATTATTACTTTTGGTACGCG133040.14987825208431485No Hit
AACTCCAGTCAACGATGTATCTCGTATGC128730.1450227554931889Illumina PCR Primer Index 2 (96% over 29bp)
TGTAAACATCCTACACTCAGCT118540.13354305473597927No Hit
CCACGTTCCCGTGG116060.1307491727067467No Hit
ACAGTAGTCTGCACATTGGTT114550.12904805905185107No Hit
CTGTCTGAGGGTCGCT109090.12289701232620195No Hit
ACTGGACAACTCTTAGCGG103100.1161488859733378No Hit
TGTAAACATCCCCGACTGGAAGCT101960.11486460149215832No Hit
AACATTCATTGCTGTCGGTGGGT101560.11441397535841114No Hit
AGCTACATCTGGCTACTGGGTCTC99330.11190173466277056No Hit
CATTGCACTTGTCTCGGTCTGA96390.10858963257972871No Hit
AACATTCATTGCTGTCGGTGGG96370.10856710127304135No Hit
AACTGGACAACTCTTAGCGG96020.10817280340601257No Hit
TGAGAACTGAATTCCATAGATG93490.10532259311006159No Hit
CAGTCCGACGATC93360.10517613961659378Illumina DpnII expression Sequencing Primer (100% over 13bp)
TGTAACAGCAACTCCATGTGGA91520.1031032594013567No Hit
TCAGTAACTGGAATCTGTCCCT91060.10258503934754742No Hit
TGAGGTAGTTGTTTGTACAGTT90650.10212314756045658No Hit
CTACGCCTGTCTGAGGGTCGCT89930.10131202051971162No Hit
GTTCTACAGTCCGACGATC88910.1001629238786563Illumina DpnII expression Sequencing Primer (100% over 19bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CATATGC454.9039954E-934.70602423
CATGCCG200.00252242534.70602423
ATAACTA2100.034.2836222
TGGTATG301.402592E-534.28361522
CGTATGC4854700.034.1155223
GATAACA601.8189894E-1233.9816521
CGCGTAT456.026312E-933.9816521
ATCTTTT456.7539077E-933.58677320
CGATAAA1350.033.58677320
TCGCGTA456.7539077E-933.58677320
TCGTATG4877900.033.54282822
CTCGTAT4860050.033.3530721
TCTCGTA4848300.033.0374220
ATCTCGT4842700.032.7590119
AGTATGC800.032.536923
CTTCGTA2300.032.5041921
GCGATAA8250.032.45917519
TCGTAGG850.032.26693322
TAACTGC700.032.22702423
ATTCGTA1550.032.1925319