FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_5_JM97_3_TGACCA_L006_R1_001_TRIMMED_prinseq_good_YKsg.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_5_JM97_3_TGACCA_L006_R1_001_TRIMMED_prinseq_good_YKsg.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9778732
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACTGACCAATCTCGTATGC663396267.84071799902073Illumina PCR Primer Index 4 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTG1640471.6775896915878254No Hit
AAGCTGCCAGCTGAAGAACTGT1004661.0273929176093588No Hit
TTCAAGTAATCCAGGATAGGCT880510.9004337167640958No Hit
GTTCTACAGTCCGAC768800.7861960016901987Illumina DpnII expression Adapter 1 (100% over 15bp)
TAGCTTATCAGACTGGTGTTGGC624360.6384876894059475No Hit
TGGAGTGTGACAATGGTGTTT607090.6208269129371784No Hit
TGGAGTGTGACAATGGTGTTTGT589570.6029104796000136No Hit
ACCACGTTCCCGTGG575660.5886857314424815No Hit
ATGACCTATGAATTGACAGCCA493120.5042780597729848No Hit
ATGACCTATGAATTGACAGCC476260.48703656056838457No Hit
CCTGTCTGAGGGTCGCT448690.458842721121716No Hit
TGAGGTAGTAGGTTGTATAGTT448490.45863819562699953No Hit
AACATTCAACGCTGTCGGTGAGT444780.4548442477000086No Hit
CTACAGTCCGACGATC443440.4534739268854081Illumina DpnII expression Sequencing Primer (100% over 16bp)
TATTGCACTTGTCCCGGCCTGT413330.42268261365584003No Hit
AACATTCAACGCTGTCGGTGAG382560.39121636629370765No Hit
AGTTCTACAGTCCGACGATC363040.37125467800937795No Hit
CACCACGTTCCCGTGG359500.36763457675289596No Hit
TCTACAGTCCGACGATC330950.3384385623821166Illumina DpnII expression Sequencing Primer (100% over 17bp)
AACTCCAGTCACTGTCCAATCTCGTATGC287200.2936986104128838Illumina PCR Primer Index 4 (96% over 29bp)
ACAGTCCGACGATC285570.29203172763094437Illumina DpnII expression Sequencing Primer (100% over 14bp)
CAGAGTTCTACAGTCCGACGATC269760.2758639872736056Illumina DpnII expression Sequencing Primer (100% over 23bp)
TGTAAACATCCTACACTCTCAGCT263850.26982025890473327No Hit
GGACAACTCTTAGCGG261630.2675500259133802No Hit
TTCAAGTAATCCAGGATAGGTT242180.24765992155220123No Hit
TGTAAACATCCTTGACTGGAAGCT240580.24602371759446928No Hit
TTCTACAGTCCGACGATC233110.2383846903668083Illumina DpnII expression Sequencing Primer (100% over 18bp)
TACAGTCCGACGATC229410.2346009687145532Illumina DpnII expression Sequencing Primer (100% over 15bp)
AACTCCAGTGACTGACCAATCTCGTATGC228210.23337381574625424Illumina PCR Primer Index 4 (96% over 29bp)
TGGACAACTCTTAGCGG216840.22174654137162159No Hit
GTTCTACAGTCCGACG216040.2209284393927556Illumina DpnII expression Sequencing Primer (100% over 16bp)
AGAGTTCTACAGTCCGACGATC209770.21451656513339357Illumina DpnII expression Sequencing Primer (100% over 22bp)
TAGTTCTACAGTCCGACGATC201620.20618215122369649Illumina DpnII expression Sequencing Primer (95% over 21bp)
TGAGGTAGTAGTTTGTATAGTT198560.20305291115453417No Hit
TGTCTGAGGGTCGCT136120.13920005170404506No Hit
AAATCCAGTCACTGACCAATCTCGTATGC127520.13040545543123586Illumina PCR Primer Index 4 (96% over 29bp)
AACTCCAGTCACGGACCAATCTCGTATGC121800.12455602628234418Illumina PCR Primer Index 4 (96% over 29bp)
TCAGTAACTGGAATCTGTCCCT118110.12078253090482488No Hit
TAGCAGCACGTAAATATTGGAG113660.11623183864738292No Hit
TGAGATGAAGCACTGTAGCTC110970.1134809707434461No Hit
CTGGACAACTCTTAGCGG108070.11051535107005693No Hit
ACTCCAGTCACTGACCAATCTCGTATGCC106800.10921661417860722Illumina PCR Primer Index 4 (100% over 29bp)
TGAGAACTGAATTCCATAGATGG105700.1080917239576665No Hit
TCAGTAACTGGAATCTGTCCCTG104840.10721226433038557No Hit
CTGTCTGAGGGTCGCT102990.10532040350425803No Hit
CATTATTACTTTTGGTACGCG97790.1000027406416292No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATGCCC200.00649607228.60669723
TAACTAA200.00649607228.60669723
AGTATGC750.028.60669523
TCGTACG503.0322553E-928.43015122
ATAACTA1450.028.43015122
TTCTGGC354.410136E-628.43015122
TAGTATG850.028.43015122
CTTCGTA3000.028.28980321
CTAGTAT750.028.28980321
CGTATGC6953300.028.22264523
TAATATG200.00700036428.17203520
CGATAAA453.7392965E-828.17203320
ATCCGTA354.907979E-628.04219
ATCTCAT453.911191E-828.04199819
GGTCCGG256.276879E-428.04199819
TCGTATG6983450.027.9294122
CTCGTAT6963700.027.84861621
CGTGTGC1850.027.83354223
TCTCGTA6954950.027.7918820
TCTTCGT3250.027.73861920