FastQCFastQC Report
Tue 7 Jun 2016
nfu_liver_mzm_5_JM98_3_ACAGTG_L008_R1_001_TRIMMED_prinseq_good_gnqo.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_liver_mzm_5_JM98_3_ACAGTG_L008_R1_001_TRIMMED_prinseq_good_gnqo.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10825385
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACTCCAGTCACACAGTGATCTCGTATGC659184660.89248557903484Illumina PCR Primer Index 5 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTG2126791.9646322047668512No Hit
AAGCTGCCAGCTGAAGAACTGT1108411.0238989190684673No Hit
ACCACGTTCCCGTGG1102681.0186058047820008No Hit
GTTCTACAGTCCGAC928220.8574475642205797Illumina DpnII expression Adapter 1 (100% over 15bp)
CCTGTCTGAGGGTCGCT879570.8125068992927272No Hit
TTCAAGTAATCCAGGATAGGCT867240.8011170041527391No Hit
TAGCTTATCAGACTGGTGTTGGC813310.7512989145420694No Hit
AACATTCAACGCTGTCGGTGAGT715270.6607340062270303No Hit
CTACAGTCCGACGATC713350.6589603972514603Illumina DpnII expression Sequencing Primer (100% over 16bp)
TGGAGTGTGACAATGGTGTTT665670.6149157743581406No Hit
ATGACCTATGAATTGACAGCCA639250.5905101758505586No Hit
TATTGCACTTGTCCCGGCCTGT627040.5792311312715437No Hit
CACCACGTTCCCGTGG584180.5396390059106443No Hit
TGGAGTGTGACAATGGTGTTTGT576710.5327385584900676No Hit
AGTTCTACAGTCCGACGATC563860.5208683109191959No Hit
ACAGTCCGACGATC552700.5105592087486958Illumina DpnII expression Sequencing Primer (100% over 14bp)
TCTACAGTCCGACGATC533010.4923704792023563Illumina DpnII expression Sequencing Primer (100% over 17bp)
ATGACCTATGAATTGACAGCC526480.48633836117606905No Hit
AACATTCAACGCTGTCGGTGAG508160.4694151755341727No Hit
TGAGGTAGTAGGTTGTATAGTT482150.4453883164432489No Hit
TAGTTCTACAGTCCGACGATC427110.3945448591435778Illumina DpnII expression Sequencing Primer (95% over 21bp)
TTCTACAGTCCGACGATC389980.3602458480691449Illumina DpnII expression Sequencing Primer (100% over 18bp)
GGACAACTCTTAGCGG382900.3537056649717308No Hit
TGGACAACTCTTAGCGG366330.3383990500106925No Hit
TACAGTCCGACGATC360810.33329992420592897Illumina DpnII expression Sequencing Primer (100% over 15bp)
CAGAGTTCTACAGTCCGACGATC343810.31759609473473693Illumina DpnII expression Sequencing Primer (100% over 23bp)
TGTAAACATCCTTGACTGGAAGCT333910.3084509234544545No Hit
TGTAAACATCCTACACTCTCAGCT313890.28995735486543894No Hit
GTTCTACAGTCCGACG299660.27681232584337645Illumina DpnII expression Sequencing Primer (100% over 16bp)
AGAGTTCTACAGTCCGACGATC298530.2757684830608796Illumina DpnII expression Sequencing Primer (100% over 22bp)
AACTCCAGTCACACAGCGATCTCGTATGC290730.2685631965976268Illumina PCR Primer Index 5 (96% over 29bp)
TTCAAGTAATCCAGGATAGGTT274170.25326581918333624No Hit
TGAGGTAGTAGTTTGTATAGTT263920.2437973337668822No Hit
TGTCTGAGGGTCGCT233400.21560434109271862No Hit
CCACGTTCCCGTGG223740.20668087093438248No Hit
TAGCAGCACGTAAATATTGGAG190760.17621544176026996No Hit
CTGTCTGAGGGTCGCT179670.1659710024170041No Hit
TGAGATGAAGCACTGTAGCTC177630.16408654288046107No Hit
CTACGCCTGTCTGAGGGTCGCT170080.15711219508590227No Hit
CTGGACAACTCTTAGCGG164330.15180060570594026No Hit
TGAGGTAGTAGTTTGTGCTGTT156760.14480778281788592No Hit
CCTGTCTGAGGGTCGCTT155120.14329282515125327No Hit
TTCACAGTGGTTAAGTTCTGCC153300.14161159164316095No Hit
TAACGGAACCCATAATGCAGCTG148210.1369096803485511No Hit
AACTCCAGTCACACAGTGATCGTATGCCG147060.1358473624725587Illumina PCR Primer Index 5 (95% over 21bp)
TGAGAACTGAATTCCATAGATGG143800.13283592223278895No Hit
CAGTCCGACGATC140610.12988914482025352Illumina DpnII expression Sequencing Primer (100% over 13bp)
TCCCATATGGTCTAGCGGTTAGGATTCCT138190.12765365850729557No Hit
CATTATTACTTTTGGTACGCG133950.12373693868624534No Hit
TCACAGTGAACCGGTCTCTTT130860.1208825367411875No Hit
TCAGTAACTGGAATCTGTCCCTGC128130.11836068647904902No Hit
TGTAAACATCCCCGACTGGAAGCT121240.11199601676984236No Hit
TCAGTAACTGGAATCTGTCCCT120350.11117387510929172No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC119600.11048105910320973No Hit
TGAGGTAGTAGATTGAATAGTT117210.10827328543049508No Hit
AGCTACATCTGGCTACTGGGTCTC114500.10576991026185212No Hit
TCAGTAACTGGAATCTGTCCCTG113580.10492005596105819No Hit
ACAGTAGTCTGCACATTGGTT111350.10286008303630771No Hit
AACATTCAACGCTGTCGGTGA110690.10225040495095555No Hit
TAGCTTATCAGACTGGTGTTGG109890.10151140121113476No Hit
ACTGGACAACTCTTAGCGG109060.10074468483107069No Hit
ACTCCAGTCACACAGTGATCTCGTATGCC108750.1004583208818901Illumina PCR Primer Index 5 (100% over 29bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AGTATGC1500.030.80507723
CGCGTAT651.8189894E-1230.26584621
CTAGTAT1650.030.26584421
CGTATGC6874650.030.2608623
TCGCATA303.4500794E-530.05485720
CGATAAA700.030.05485720
GGGACCC200.00510324930.05485520
GCTCCTG750.029.8505119
GCGATCA1000.029.85050619
TCGTATG6901600.029.83515522
CTTCGTA2950.029.75286321
CTCGTAT6871600.029.72959521
TCTCGTA6861300.029.56907720
TAGTATG1650.029.56725522
ATCTCGT6846200.029.4136219
CGTGTGC2050.029.30238723
AGGCTTC1550.029.28952621
AGACAAC7800.029.2842220
GCGATAA10300.029.27088519
ATTTCGT2200.029.17208719