FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_10_JG57_5_CTTGTA_L002_R1_001_TRIMMED_prinseq_good_ych0.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_10_JG57_5_CTTGTA_L002_R1_001_TRIMMED_prinseq_good_ych0.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences19672059
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT9513354.835970652589035No Hit
AACATTCAACGCTGTCGGTGAG8152184.144040031600149No Hit
AACATTCAACGCTGTCGGTGAGT6874273.494433399167825No Hit
TACCCTGTAGAACCGAATTTGT5944373.0217324988706062No Hit
TTCCCTTTGTCATCCTATGCCT4797612.4387940276104296No Hit
AACAGTAAGAGTTTATGTGCTG4421962.247837910612204No Hit
TGAGGTAGTAGGTTGTATAGTT4359902.216290628245879No Hit
AAGCTGCCAGCTGAAGAACTGT3391701.7241204898785631No Hit
TACCCTGTAGAACCGAATTTGC3049431.5501326017779837No Hit
TAGCTTATCAGACTGGTGTTGGC2943051.4960559034516925No Hit
TTGGTCCCCTTCAACCAGCTGT2734481.3900324312772752No Hit
CCTGTCTGAGGGTCGCT2642871.343463843820314No Hit
TACCCTGTAGAACCGAATTTGCG2592891.3180572506416335No Hit
TCCTTCATTCCACCGGAGTCTG2479491.2604120392278204No Hit
TATTGCACTTGTCCCGGCCTGT1920760.9763899142433438No Hit
AACATTCAACGCTGTCGGTGA1890340.9609263575307496No Hit
TTTGGTCCCCTTCAACCAGCTGT1672630.8502567016497866No Hit
ACAGTAGTCTGCACATTGGTT1656610.8421131717833908No Hit
TTCACGTAATCCAGGATAGGCT1406710.7150802058899884No Hit
TTCACAGTGGTTAAGTTCTG1310240.6660411093724352No Hit
CCACGTTCCCGTGG1229100.6247947914348976No Hit
TTCACAGTGGCTAAGTTCTG1213740.6169867627989526No Hit
TTAGGTAGTAGGTTGTATAGTT1203750.6119084941744024No Hit
TCCTTCATTCCACCGGAGTCTGT1193480.6066878916945095No Hit
ACCCTGTAGAACCGAATTTGCG1182810.6012639551355554No Hit
CTACGCCTGTCTGAGGGTCGCT1164770.5920935881699013No Hit
CCTTTCTGAGGGTCGCT1152250.5857292314952898No Hit
TTATGTAGTAGGTTGTATAGTT1135920.5774281177176217No Hit
TTGTTCCCCTTCAACCAGCTGT1033370.5252983431983403No Hit
TGATGTAGTAGGTTGTATAGTT1028400.5227719172660066No Hit
TTCACAGTGGCTAAGTTCTGC969230.492693723620898No Hit
AACTCCAGTCACCTTGTAATCT886200.4504866521597968Illumina PCR Primer Index 12 (100% over 22bp)
CTGTCTGAGGGTCGCT828490.42115062790326113No Hit
TTCACAGTGGCTAAGTTCAGT793020.40311997844252095No Hit
TTCAAGTAATCCAGGATAGGTT754250.3834118228295269No Hit
TGAGGTAGTAGTTTGTATAGTT684510.3479605261452296No Hit
TAGCTTATCAGACTGGTGTTGG677000.3441429288108581No Hit
AAGCTGCCAGCTGAAGAACT655400.3331628885415604No Hit
ACATTAGTCTGCACATTGGTT651320.3310888809351375No Hit
TTTGGTCCCCTTCAACCAGCTG645000.3278762024859726No Hit
TACCCTGTAGATCCGGATTTGT641070.3258784451591976No Hit
TACAGTAGTCTGCACATTGGTT635150.3228691007890938No Hit
TAACGGAACCCATAATGCAGCTG632050.3212932616763705No Hit
TTTTGTCCCCTTCAACCAGCTGT627240.3188481693756612No Hit
TGAGGTAGTAGGTTGTATAGT613430.3118280602960778No Hit
AACTCCAGTCACCTTGTAATCTCG600000.30500111859160245Illumina PCR Primer Index 12 (100% over 24bp)
TACCATGTAGAACCGAATTTGT557360.2833257057636926No Hit
AAGCTGCCAGCTGAAGAACTGC555480.28237003559210555No Hit
TTCAAGTAATCCAGGATAGGC555140.28219720162490364No Hit
TGTCTGAGGGTCGCT529570.2691990706209248No Hit
TCCTTCATTCCACCGGAGTCT513690.2611267076822004No Hit
TGAGGTAGTAGGTTGTATAGTTT503470.25593152196219016No Hit
CATTGCACTTGTCTCGGTCTGA492560.2503855849557995No Hit
TCCAGCATCAGTGATTTTGTT478260.2431163916293663No Hit
ACAGTAGTCTGCACATTGGTTA457670.2326497699096978No Hit
AACTCCAGTCACCTTGTAATCTC455180.23138401526754268Illumina PCR Primer Index 12 (100% over 23bp)
TCCAGCATCAGTGATTTTGTTG445800.2266158311135606No Hit
TTCAAGTAATCCAGGATAGGCTT438210.22275756696337684No Hit
TTCCATTTGTCATCCTATGCCT431020.21910263689225415No Hit
TACCCTGTAGAACCGAATTTG429930.2185485515268127No Hit
ACCCTGTAGAACCGAATTTGTG425070.21607804246622075No Hit
TTCAGTCATTGTTTCTGGTTGT417510.21223502837196656No Hit
TTCACAGTGGTTAAGTTCTGCC414450.2106795226671494No Hit
TTCACAGTGGTTAAGTTCTGC392700.19962323211820382No Hit
TTCCCTTTGTCATCCTATGCCTG373020.18961919542839922No Hit
TATTGCACTTGTCCCGGCCTGTT363450.18475442758686317No Hit
AACTCCAGTCACCTTGTAATCTCGTATGC341110.1733982192713025Illumina PCR Primer Index 12 (100% over 29bp)
TATGTGCCCTTGGACTACATCG336020.1708107931152504No Hit
GAAGGATCATTA328890.1671863631559869No Hit
TTCAAGTAATCCAGGATGGGCT327530.16649502728717924No Hit
AACCCGTAGATCCGAACTTGTG323390.1643905195688972No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC314630.15993750323745978No Hit
CACCACGTTCCCGTGG314360.15980025273409357No Hit
ATGACCTATGAATTGACAGCC313820.1595257517273611No Hit
TCCCTGAGACCCTTAACCTGTG311950.15857516490775064No Hit
AACATTCATTGCTGTCGGTGGG292200.14853554475411038No Hit
TACAGTACTGTGATAACTGAAG291370.1481136265400587No Hit
TGAGATGAAGCACTGTAGCTCT290210.14752395771078156No Hit
TCAGTAACTGGAATCTGTCCCT283450.14408761177464952No Hit
AACATTCATTGCTGTCGGTGGGT272960.138755175551273No Hit
CATTATTACTTTTGGTACGCG265870.13515107899991557No Hit
TGAGGTAGTAGATTGAATAGTT264570.1344902432429671No Hit
TGAGATGAAGCACTGTAGCTC261410.13288390401838465No Hit
ACCCTGTAGAACCGAATTTGC261210.1327822369788541No Hit
ACCCTGTAGAACCGAATTTGT258130.13121656457008388No Hit
TTTCTGAGGGTCGCT251300.12774463517011614No Hit
TTCCAGTGATGACAGCCTATAATCTGACT250860.12752096768314897No Hit
TACCATGTAGAACCGAATTTGCG245380.12473529080001235No Hit
TCCCTGAGACCCTAACTTGTGA244120.12409478845096997No Hit
GAGAGAGGCATGATCGTAGCGATA240080.12204111425245319No Hit
TTTTGTCCCCTTCAACCAGCTG238950.12146669547910566No Hit
TTCACAGTGGCTAAGTTCTGCT231740.11780159870402993No Hit
TACCCTGTAGAACCGAATGTGT229030.11642401031839117No Hit
TGTAAACATCCTTGACTGGAAGCT224410.11407550170523585No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT223440.11358241656351274No Hit
TGAGGTAGTTGGTTGTATAGTT223170.11344516606014653No Hit
TCCAGTGATGACAGCCTATAATCTGACT221520.11260641298401963No Hit
TGTAAACATCCTACACTCTCAGCT216990.11030365453865301No Hit
ATGACCTATGAATTGACAGCCA216420.11001390347599099No Hit
AACATTCAACGCTGTCGGTGAGA213580.10857023151465742No Hit
ACCACGTTCCCGTGG209150.10631830658905608No Hit
AACATTCAACGCTGTCGGTGG208210.10584047150326258No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG205330.10437646613402289No Hit
AACACTCAACGCTGTCGGTGAG202230.1028006270212996No Hit
TACCCTGTAGAACCGAATTTGTG199910.10162128936274539No Hit
TTCACAGTGGTTAAGTTCTGCCT198900.10110787081311622No Hit
CCCAGTGTTCAGACTACCTGTT198690.10100112042160914No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC36100.01136.711223
GATTCCT30250.01032.99623
AATAACC3450.0769.02723
TAACTGC5500.0728.944323
TCGTATG37750.0558.7812522
GGATTCC71850.0551.3445422
ATAACTA12750.0524.405822
ACAACCC6650.0476.026822
TTCTCGC38950.0449.5697323
TCTGACT78300.0445.7671523
AAATAGC3000.0432.36423
TAATAAC4700.0428.03622
TAACTAA1950.0423.2934323
GCATAGC2700.0416.3792722
CCCGCCT2900.0406.6119423
AGGCGTA303.581631E-4393.058223
CTCGTAT53450.0366.0566421
GACAACC12050.0364.5793521
ATTCGGC13700.0348.588123
CGATAAA9900.0342.3779320