FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_10_JG58_5_AGTCAA_L003_R1_001_TRIMMED_prinseq_good__OZl.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_10_JG58_5_AGTCAA_L003_R1_001_TRIMMED_prinseq_good__OZl.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20963316
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT10661205.08564580145622No Hit
AACATTCAACGCTGTCGGTGAG8472924.04178422917443No Hit
AACATTCAACGCTGTCGGTGAGT7538263.595929193644746No Hit
TTCCCTTTGTCATCCTATGCCT6196452.9558539307426366No Hit
TACCCTGTAGAACCGAATTTGT5948752.837695143268365No Hit
TGAGGTAGTAGGTTGTATAGTT4916392.3452348855495955No Hit
AACAGTAAGAGTTTATGTGCTG4445062.1203992727104817No Hit
CCTGTCTGAGGGTCGCT4188331.9979329606060414No Hit
AAGCTGCCAGCTGAAGAACTGT3552981.6948559092464188No Hit
TCCTTCATTCCACCGGAGTCTG3235611.5434628758160207No Hit
TACCCTGTAGAACCGAATTTGC2911991.3890884438320732No Hit
TAGCTTATCAGACTGGTGTTGGC2831951.3509074613958976No Hit
TTGGTCCCCTTCAACCAGCTGT2807421.3392060683529268No Hit
TACCCTGTAGAACCGAATTTGCG2525501.2047235275182608No Hit
TATTGCACTTGTCCCGGCCTGT2328511.110754615348068No Hit
ACAGTAGTCTGCACATTGGTT2093490.9986444892592374No Hit
AACATTCAACGCTGTCGGTGA1956200.933153896072549No Hit
TTTGGTCCCCTTCAACCAGCTGT1802510.8598401130813464No Hit
TCCTTCATTCCACCGGAGTCTGT1485650.708690361772918No Hit
CTACGCCTGTCTGAGGGTCGCT1346350.6422409508114079No Hit
TTCACAGTGGCTAAGTTCTG1308700.624281005924826No Hit
TTCACAGTGGTTAAGTTCTG1205640.575118936336217No Hit
TTCACGTAATCCAGGATAGGCT1157840.5523172001986708No Hit
ACCCTGTAGAACCGAATTTGCG1126570.5374006669555522No Hit
AACTCCAGTCACAGTCAAATCT1105260.52723529044737TruSeq Adapter, Index 13 (95% over 22bp)
CTGTCTGAGGGTCGCT1095620.5226367813183754No Hit
TGAGGTAGTAGTTTGTATAGTT1010860.4822042466945592No Hit
TTCACAGTGGCTAAGTTCTGC981550.4682226800378337No Hit
TGTCTGAGGGTCGCT936140.44656103070716485No Hit
AAGCTGCCAGCTGAAGAACT791690.37765494733753No Hit
CCACGTTCCCGTGG787290.3755560427558312No Hit
TTCACAGTGGCTAAGTTCAGT784650.3742967000068119No Hit
TTCAAGTAATCCAGGATAGGTT778640.3714297871577188No Hit
TTCCCTTTGTCATCCTATGCCTG696190.33209917743929446No Hit
TAACGGAACCCATAATGCAGCTG689170.3287504705839477No Hit
TGAGGTAGTAGGTTGTATAGT683350.3259741922508825No Hit
CCTTTCTGAGGGTCGCT672940.3210083748200905No Hit
TGATGTAGTAGGTTGTATAGTT671880.3205027296254085No Hit
TACAGTAGTCTGCACATTGGTT657320.3135572635550597No Hit
TTTGGTCCCCTTCAACCAGCTG646000.30815735449487097No Hit
TTCAAGTAATCCAGGATAGGC643040.30674536413990994No Hit
AACTCCAGTCACAGTCAAATCTCG626130.29867889221342653TruSeq Adapter, Index 13 (95% over 24bp)
TAGCTTATCAGACTGGTGTTGG600680.2865386373033732No Hit
AAGCTGCCAGCTGAAGAACTGC598990.2857324671344934No Hit
TACCCTGTAGATCCGGATTTGT593610.283166079259598No Hit
AACTCCAGTCACAGTCAAATCTC580650.2769838512189579TruSeq Adapter, Index 13 (95% over 23bp)
CATTGCACTTGTCTCGGTCTGA580260.27679781194921643No Hit
ACAGTAGTCTGCACATTGGTTA576480.27499466210402973No Hit
TGAGGTAGTAGGTTGTATAGTTT542500.25878539444809207No Hit
TCCTTCATTCCACCGGAGTCT497690.23740995937856396No Hit
TGAGATGAAGCACTGTAGCTC495710.2364654523167995No Hit
ATGACCTATGAATTGACAGCC484030.2308938146999263No Hit
TTCAAGTAATCCAGGATAGGCTT476160.22713963764129683No Hit
AACTCCAGTCACAGTCAAATCTCGTATGC472720.22549867587742323TruSeq Adapter, Index 13 (96% over 29bp)
ACCCTGTAGAACCGAATTTGTG468090.22329005582895378No Hit
TGAGATGAAGCACTGTAGCTCT452760.2159772814568077No Hit
TCCAGCATCAGTGATTTTGTTG443240.21143601518004118No Hit
TATGTGCCCTTGGACTACATCG439000.20941343440131324No Hit
TATTGCACTTGTCCCGGCCTGTT432940.20652267036379168No Hit
TACCCTGTAGAACCGAATTTG424710.20259676474847776No Hit
TTGTTCCCCTTCAACCAGCTGT417620.1992146662293313No Hit
TTCCATTTGTCATCCTATGCCT410050.19560359630127216No Hit
TACCATGTAGAACCGAATTTGT405910.19362871789940103No Hit
TCCAGCATCAGTGATTTTGTT405020.19320416674537558No Hit
TGTAAACATCCTTGACTGGAAGCT403990.19271283226375063No Hit
CACCACGTTCCCGTGG400240.19092399313162098No Hit
AACATTCATTGCTGTCGGTGGG399200.19042788841231034No Hit
TTCAGTCATTGTTTCTGGTTGT390120.1860965125937137No Hit
TTCACAGTGGTTAAGTTCTGCC381790.18212290460154298No Hit
ATGACCTATGAATTGACAGCCA374190.17849752396042687No Hit
TACCCTGTAGAACCGAATGTGT367040.1750868040151663No Hit
AACATTCATTGCTGTCGGTGGGT365820.17450483501751346No Hit
CATTATTACTTTTGGTACGCG350560.1672254523091671No Hit
TGAGGTAGTAGATTGAATAGTT350090.1670012511379402No Hit
TTCCAGTGATGACAGCCTATAATCTGACT347520.16577530005272068No Hit
TTAGGTAGTAGGTTGTATAGTT343770.163986460920591No Hit
TTCACAGTGGTTAAGTTCTGC342180.16322799312856803No Hit
TGTAAACATCCTACACTCTCAGCT336850.16068545644210105No Hit
GAAGGATCATTA327400.1561775818291343No Hit
AACCCGTAGATCCGAACTTGTG320360.1528193344984162No Hit
TACAGTACTGTGATAACTGAAG313520.14955649192141168No Hit
CACGTTCCCGTGG299240.1427445925062619No Hit
TTCAAGTAATCCAGGATGGGCT293560.14003509750079615No Hit
TGAGGTAGTTGGTTGTATAGTT289340.13802205719743957No Hit
TCCAGTGATGACAGCCTATAATCTGACT273670.13054709474398038No Hit
TTTTGTCCCCTTCAACCAGCTGT257130.12265712161186712No Hit
ACCACGTTCCCGTGG246960.11780578988553148No Hit
TCCCTGAGACCCTTAACCTGTG246170.11742894110836281No Hit
TTCACAGTGGCTAAGTTCTGCT245680.11719519946176454No Hit
AACATTCAACGCTGTCGGTGG239790.11438552946489954No Hit
ACCCTGTAGAACCGAATTTGC239510.11425196280970053No Hit
ACCCTGTAGAACCGAATTTGT239460.11422811162127212No Hit
TGAGGTAGTAGTTTGTGCTGTT235210.1122007606048585No Hit
TACCCTGTAGAACCGAATTTGTG233710.11148522495200665No Hit
TATTGCACTTGTCCCGGCCTGTAT226770.10817467999814533No Hit
TACGCCTGTCTGAGGGTCGCT225530.10758317052512112No Hit
TATTGCACTTGTCCCGGCCTGTTT221500.10566076473779244No Hit
TTTGGTCCCCTTCAACCAGCT220980.10541271237813712No Hit
TGTAAACATCCCCGACTGGAAGCT220260.10506925526476822No Hit
TATTGCACTTGTCCCGGCCTGTA214820.10247424596375879No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC50050.0854.2734423
TAACTGC4800.0655.7727723
GATTCCT17050.0648.7214423
CAACCCG10550.0638.161223
AATAACC4250.0596.6246323
TAACTAA1250.0594.567323
ATAACTA14600.0455.1324522
TCGTATG51950.0453.7873522
GTATGCC1350.0420.9899323
ACAACCC19950.0415.4665222
TCTGACT98350.0358.724723
GGATTCC34750.0352.0360422
TAATAAC7000.0318.6616222
AAATAGC3550.0307.8745423
GACAACC33050.0294.1437721
CTCGTAT76700.0291.6439821
TTCTCGC29300.0253.65523
TCTCGTA82700.0248.7892520
CGATAAA8150.0247.8450320
CGATAAC63650.0243.0987420