FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_10_JG59_5_AGTTCC_L004_R1_001_TRIMMED_prinseq_good_Ajaj.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_10_JG59_5_AGTTCC_L004_R1_001_TRIMMED_prinseq_good_Ajaj.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences23465290
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT14638586.238397224155338No Hit
AACATTCAACGCTGTCGGTGAG9731524.147197839873277No Hit
TTCCCTTTGTCATCCTATGCCT9122193.8875249357668284No Hit
AACATTCAACGCTGTCGGTGAGT8504353.6242253984502217No Hit
TACCCTGTAGAACCGAATTTGT6326102.695939406672579No Hit
TCCTTCATTCCACCGGAGTCTG6252752.6646804706014713No Hit
AAGCTGCCAGCTGAAGAACTGT4707932.0063378718098095No Hit
TGAGGTAGTAGGTTGTATAGTT4325871.8435186609669005No Hit
AACAGTAAGAGTTTATGTGCTG3606941.5371384713336167No Hit
TAGCTTATCAGACTGGTGTTGGC3419041.4570627509824086No Hit
CCTGTCTGAGGGTCGCT3398171.4481687633095521No Hit
TACCCTGTAGAACCGAATTTGC3253901.386686463282576No Hit
TCCTTCATTCCACCGGAGTCTGT3058211.3032909459035025No Hit
TACCCTGTAGAACCGAATTTGCG2530551.0784226404191042No Hit
AACATTCAACGCTGTCGGTGA2318990.988263942188654No Hit
ACAGTAGTCTGCACATTGGTT2092890.8919088577213408No Hit
TATTGCACTTGTCCCGGCCTGT1931360.8230710125466167No Hit
TTGGTCCCCTTCAACCAGCTGT1649950.7031449430200948No Hit
TTCACAGTGGTTAAGTTCTG1577560.6722951218587113No Hit
TTCACAGTGGCTAAGTTCTG1407880.5999840615649754No Hit
TCCTTCATTCCACCGGAGTCT1299790.5539202796982265No Hit
TTCAAGTAATCCAGGATAGGTT1271830.542004807952512No Hit
AAGCTGCCAGCTGAAGAACT1125350.4795806913104419No Hit
TAACGGAACCCATAATGCAGCTG1070170.45606510722859167No Hit
TTCACAGTGGCTAAGTTCTGC1060180.45180775519927513No Hit
TTCACAGTGGCTAAGTTCAGT1030390.439112408156899No Hit
ACCCTGTAGAACCGAATTTGCG1025720.43712223458563687No Hit
CCACGTTCCCGTGG999740.42605056234122823No Hit
CTACGCCTGTCTGAGGGTCGCT957270.4079514891995794No Hit
CTGTCTGAGGGTCGCT923950.39375179254123854No Hit
TTCAGTCATTGTTTCTGGTTGT908720.38726135496301134No Hit
TTCAAGTAATCCAGGATAGGC871440.3713740593020585No Hit
AACTCCAGTCACAGTTCCATCT869210.3704237194596785TruSeq Adapter, Index 14 (95% over 22bp)
TGAGGTAGTAGTTTGTATAGTT862340.3674959908869654No Hit
TTAGGTAGTAGGTTGTATAGTT861710.36722750922745895No Hit
TTTGGTCCCCTTCAACCAGCTGT806250.3435925999636058No Hit
ATGACCTATGAATTGACAGCC767530.32709163193806684No Hit
TAGCTTATCAGACTGGTGTTGG758620.32329453418218995No Hit
TTCAAGTAATCCAGGATAGGCTT728210.31033496709395025No Hit
TGAGGTAGTAGGTTGTATAGT693380.29549176677552247No Hit
TTCCCTTTGTCATCCTATGCCTG682710.2909446250184848No Hit
AAGCTGCCAGCTGAAGAACTGC574840.24497459865188112No Hit
AACTCCAGTCACAGTTCCATCTCG574560.2448552734698783TruSeq Adapter, Index 14 (95% over 24bp)
TGAGGTAGTAGGTTGTATAGTTT563750.2402484691218391No Hit
TTCACGTAATCCAGGATAGGCT563040.239945894553189No Hit
ATGACCTATGAATTGACAGCCA559780.23855660850558422No Hit
AACATTAAGAGTTTATGTGCTG546350.23283326138308966No Hit
TGTCTGAGGGTCGCT537230.22894666974071065No Hit
ACAGTAGTCTGCACATTGGTTA529820.2257888140312777No Hit
TTCACAGTGGTTAAGTTCTGCC504790.21512199508295018No Hit
AACTCCAGTCACAGTTCCATCTCGTATGC490230.2089170856188012TruSeq Adapter, Index 14 (96% over 29bp)
TACCCTGTAGAACCGAATTTG486380.20727636436626184No Hit
TACCCTGTAGATCCGGATTTGT485670.2069737897976117No Hit
TACAGTAGTCTGCACATTGGTT460080.19606832048527847No Hit
CATTGCACTTGTCTCGGTCTGA447870.19086489022722497No Hit
TTCACAGTGGTTAAGTTCTGC442890.18874260663303116No Hit
CACCACGTTCCCGTGG432340.18424660423970893No Hit
TTCCAGTGATGACAGCCTATAATCTGACT425220.18121233532592182No Hit
AACTCCAGTCACAGTTCCATCTC424960.18110153337120488TruSeq Adapter, Index 14 (95% over 23bp)
TATTGCACTTGTCCCGGCCTGTT420210.17907726689079914No Hit
TGAGATGAAGCACTGTAGCTCT417360.1778627070025557No Hit
TACCCTGTAGAACCGAATGTGT409350.17444915447454515No Hit
TATGTGCCCTTGGACTACATCG407860.1738141740417442No Hit
TGAGATGAAGCACTGTAGCTC367190.1564821913558281No Hit
ACCCTGTAGAACCGAATTTGTG365880.15592391996860044No Hit
AACATTCATTGCTGTCGGTGGG355110.15133416207513312No Hit
AACCCGTAGATCCGAACTTGTG349460.148926350366861No Hit
AACATTCATTGCTGTCGGTGGGT345960.1474347855918252No Hit
TGAGGTAGTAGATTGAATAGTT341070.14535085652041804No Hit
AACATTCAACGCTGTCGGTGAGA305820.13032866842898597No Hit
TCCAGCATCAGTGATTTTGTT304850.1299152919056189No Hit
TTTGGTCCCCTTCAACCAGCTG303650.12940389826846377No Hit
TTTAAGTAATCCAGGATAGGCT299280.12754157310649047No Hit
TGAAATGTTTAGGACCACTTGT296540.12637389096831958No Hit
TGAGTTAGTAGGTTGTATAGTT296110.12619064158167234No Hit
TGAGAACTGAATTCCATAGATGG294330.12543207435322554No Hit
TGTAAACATCCTTGACTGGAAGCT291470.12421325285133915No Hit
TCCAGCATCAGTGATTTTGTTG287910.12269611839444558No Hit
TACAGTACTGTGATAACTGAAG286710.12218472475729045No Hit
TTCACAGTGGTTAAGTTCTGCCT279430.11908227002521597No Hit
CATTATTACTTTTGGTACGCG276510.11783787884147182No Hit
AACATTCAACGCTGTCGGTGG267310.11391719428994912No Hit
TTCACAGTGGCTAAGTTCTGCT266180.1134356319482947No Hit
TACGCCTGTCTGAGGGTCGCT265920.11332482999357775No Hit
TGTAAACATCCTACACTCTCAGCT263300.11220828721912238No Hit
TCCCTGAGACCCTTAACCTGTG260770.11113009896745363No Hit
ACCCTGTAGAACCGAATTTGT258260.11006043394307082No Hit
ACCCTGTAGAACCGAATTTGC255550.1089055366458288No Hit
GAAGGATCATTA253320.10795519680344882No Hit
CACGTTCCCGTGG249390.10628038264176579No Hit
CCTTTCTGAGGGTCGCT249280.10623350489169321No Hit
ACCACGTTCCCGTGG246100.1048783117532321No Hit
TAACACTGTCTGGTAACGATGT241950.10310974209140394No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT240000.10227872743102685No Hit
TGGACGGAGAACTGATAAGGGC239510.10206990836252185No Hit
TCCAGTGATGACAGCCTATAATCTGACT235540.10037804774626694No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC56700.0817.38923
GATTCCT33550.0734.26923
CAACCCG5650.0563.0881323
TAACTGC7050.0512.2514623
AATAACC5300.0454.2607723
TCTGACT109950.0383.1985823
TCGTATG59550.0383.129722
ATAACTA16550.0371.6259222
GGATTCC57950.0361.1324822
ACAACCC13650.0328.6403822
TAACTAA2800.0322.4440323
CGTATTC704.1654857E-10307.0895723
GCATAGC3850.0263.615322
TACCCGC950.0256.4005422
ACGAAGT1600.0241.8330223
AAATAGC3950.0239.452123
CTCGTAT80850.0236.2135621
TAATAAC7900.0223.5391122
CATAGCT2700.0222.9242623
GACAACC22250.0219.977321