FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_10_JG60_5_ATGTCA_L005_R1_001_TRIMMED_prinseq_good_bjZk.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_10_JG60_5_ATGTCA_L005_R1_001_TRIMMED_prinseq_good_bjZk.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences21498364
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC18123898.430357770479652No Hit
ATGACCTATGAATTGACAGCCA14184936.598143933184869No Hit
TTCAAGTAATCCAGGATAGGCT9175584.268036395699691No Hit
AACATTCAACGCTGTCGGTGAG5591762.6010165238620018No Hit
TAGCTTATCAGACTGGTGTTGGC4895632.277210489133034No Hit
AACATTCAACGCTGTCGGTGAGT4773922.2205968789066928No Hit
TACCCTGTAGAACCGAATTTGT4549922.116402903960506No Hit
TGAGGTAGTAGGTTGTATAGTT4271801.9870349204246425No Hit
AAGCTGCCAGCTGAAGAACTGT3101131.4424958103788734No Hit
TTCCCTTTGTCATCCTATGCCT3100751.442319052742804No Hit
CCTGTCTGAGGGTCGCT3022711.4060186161142307No Hit
AACAGTAAGAGTTTATGTGCTG2887101.34293939762114No Hit
TACCCTGTAGAACCGAATTTGC2433521.1319559013885894No Hit
TACCCTGTAGAACCGAATTTGCG2287961.0642484237405228No Hit
TGAGATGAAGCACTGTAGCTCT2103190.9783023489601349No Hit
TCCTTCATTCCACCGGAGTCTG2101060.9773115758947983No Hit
TGAGATGAAGCACTGTAGCTC1962900.9130462206333468No Hit
TATTGCACTTGTCCCGGCCTGT1853470.8621446729620914No Hit
ACAGTAGTCTGCACATTGGTT1753520.8156527631590943No Hit
TTCACAGTGGTTAAGTTCTG1607560.7477592248414809No Hit
TTGGTCCCCTTCAACCAGCTGT1604900.746521921388995No Hit
TAACGGAACCCATAATGCAGCTG1474770.6859917340686947No Hit
AACATTCAACGCTGTCGGTGA1465750.6817960659704152No Hit
TGTAACAGCAACTCCATGTGGA1337290.6220426819454726No Hit
TCCTTCATTCCACCGGAGTCTGT1083230.5038662476828469No Hit
TTCACAGTGGCTAAGTTCTG1077400.5011544134242029No Hit
TTTGGTCCCCTTCAACCAGCTGT1019510.47422678302404775No Hit
ATGACCTATGAATTGACAGCCAT1000050.4651749314505978No Hit
TGAGATGAAGCACTGTAGCT974990.45351823050349316No Hit
TGAGGTAGTAGTTTGTATAGTT901300.41924120365624096No Hit
ACCCTGTAGAACCGAATTTGCG891220.41455247478366264No Hit
CTACGCCTGTCTGAGGGTCGCT876570.4077380027615125No Hit
TTCAAGTAATCCAGGATAGGTT818240.3806057056248559No Hit
TTCACAGTGGCTAAGTTCTGC813970.3786195079774442No Hit
ATGACCTATGAATTGACAGC807690.3756983554655601No Hit
CTGTCTGAGGGTCGCT787820.36645579170582465No Hit
TAGCTTATCAGACTGGTGTTGG770730.3585063495994393No Hit
ATGACCTATGAATTGACAGCCT768720.3575713947349668No Hit
TACCCTGTAGATCCGGATTTGT679030.31585194110584414No Hit
TGTCTGAGGGTCGCT641120.2982180411495498No Hit
TGAGGTAGTAGGTTGTATAGT636150.2959062373304313No Hit
AAGCTGCCAGCTGAAGAACT628260.29223619062362144No Hit
AACTCCAGTCACATGTCAATCT626860.29158497828020774TruSeq Adapter, Index 15 (95% over 22bp)
CCACGTTCCCGTGG602440.2802259744043779No Hit
TTCAAGTAATCCAGGATAGGC558580.25982442198857547No Hit
TTCACAGTGGCTAAGTTCAGT534750.24873985760032716No Hit
AAGCTGCCAGCTGAAGAACTGC528860.2460001142412511No Hit
TGAGGTAGTAGGTTGTATAGTTT526170.24474885623854914No Hit
TTCACAGTGGTTAAGTTCTGCC525100.24425114394751152No Hit
TACCCTGTAGAACCGAATGTGT484280.2252636526202645No Hit
TACAGTAGTCTGCACATTGGTT453440.21091837499820917No Hit
CATTGCACTTGTCTCGGTCTGA442030.2056109943993878No Hit
TTCACAGTGGTTAAGTTCTGC441340.20529003974441964No Hit
TGTAAACATCCTTGACTGGAAGCT437640.20356897855111208No Hit
CCTTTCTGAGGGTCGCT426440.19835927980380275No Hit
ACAGTAGTCTGCACATTGGTTA423270.19688474899764466No Hit
TTCAAGTAATCCAGGATAGGCTT416500.19373567216556573No Hit
TCAGTAACTGGAATCTGTCCCT411700.19150294413100458No Hit
TTCCCTTTGTCATCCTATGCCTG382210.17778562126866956No Hit
CACCACGTTCCCGTGG381300.1773623332454507No Hit
TATTGCACTTGTCCCGGCCTGTT373560.17376205928972083No Hit
TGAGGTAGTAGATTGAATAGTT367910.17113395233237283No Hit
TATGTGCCCTTGGACTACATCG366790.1706129824576419No Hit
TACCCTGTAGAACCGAATTTG365900.17019899746790035No Hit
AACTCCAGTCACATGTCAATCTCG339860.15808644788040616TruSeq Adapter, Index 15 (95% over 24bp)
AACTCCAGTCACATGTCAATCTC337280.15688635656182953TruSeq Adapter, Index 15 (95% over 23bp)
TGTAAACATCCTACACTCTCAGCT336970.1567421595429308No Hit
TGAGAACTGAATTCCATAGATGG329260.15315584013741698No Hit
CATTATTACTTTTGGTACGCG327110.15215576403860312No Hit
TTTGGTCCCCTTCAACCAGCTG324360.15087659693546915No Hit
TCCAGCATCAGTGATTTTGTT319940.14882062653697742No Hit
TCCAGCATCAGTGATTTTGTTG313980.14604832256073066No Hit
TCCTTCATTCCACCGGAGTCT300620.13983389619786882No Hit
ACCCTGTAGAACCGAATTTGTG292380.13600104640520552No Hit
TTCCAGTGATGACAGCCTATAATCTGACT290130.134954455139005No Hit
AACCCGTAGATCCGAACTTGTG289180.13451256104883144No Hit
TACCCTGTAGATCCGGATTTGTG283740.1319821359429955No Hit
AACTCCAGTCACATGTCAATCTCGTATGC276440.12858652872376708TruSeq Adapter, Index 15 (96% over 29bp)
TCCCATATGGTCTAGCGGTTAGGATTCCT271850.126451482540718No Hit
TTCAGTCATTGTTTCTGGTTGT269490.12535372459039207No Hit
TTCACAGTGGTTAAGTTCTGCCT236210.1098734768841015No Hit
CATAAAGTAGAAAGCACTACT233120.10843615821185276No Hit
AACATTCATTGCTGTCGGTGGG224580.10446376291702941No Hit
TGAGGTAGTTGGTTGTATAGTT221310.10294271694348463No Hit
TGATGTAGTAGGTTGTATAGTT219190.10195659539488679No Hit
TAGCAGCACGTAAATATTGGAG215110.10005877656550982No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC30850.0695.4314623
GATTCCT36300.0570.9523323
CAACCCG4900.0431.1477723
TAACTGC6150.0337.593423
TCGTATG32200.0306.220122
ATAACTA12000.0274.3473822
GGATTCC50600.0268.904122
TCTGACT85100.0268.368923
TAACTAA2900.0238.6435923
GTACTCT11450.0229.045223
ACAACCC11600.0222.2926522
AATAACC4000.0218.547323
GCATAGC4100.0181.9533122
TTCTCGC22250.0180.0764223
TTACGCC656.820451E-5168.1133123
ACACGCC6750.0167.2831323
CTCGTAT47550.0165.264921
GCTTCCT4700.0162.74823
TCTCGCC10250.0156.3590523
TCTCGTA44600.0151.8115220