FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_10_JG61_5_GGCTAC_L001_R1_001_TRIMMED_prinseq_good_Cmfk.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_10_JG61_5_GGCTAC_L001_R1_001_TRIMMED_prinseq_good_Cmfk.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15952395
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT8821385.529815428968503No Hit
AACATTCAACGCTGTCGGTGAG7297714.574679852147593No Hit
AACATTCAACGCTGTCGGTGAGT6394604.008551693961941No Hit
TCCTTCATTCCACCGGAGTCTG4345342.723942078916677No Hit
TACCCTGTAGAACCGAATTTGT3837782.4057704187991833No Hit
TTCCCTTTGTCATCCTATGCCT3806042.385873719902247No Hit
AAGCTGCCAGCTGAAGAACTGT3368392.1115262002978237No Hit
AACAGTAAGAGTTTATGTGCTG2735931.7150590867390132No Hit
TAGCTTATCAGACTGGTGTTGGC2648931.6605218213315305No Hit
TGAGGTAGTAGGTTGTATAGTT2319961.4543020029280869No Hit
TACCCTGTAGAACCGAATTTGC2052161.2864275238921803No Hit
TCCTTCATTCCACCGGAGTCTGT2006901.2580556085778969No Hit
CCTGTCTGAGGGTCGCT1986121.2450293513920636No Hit
TACCCTGTAGAACCGAATTTGCG1675001.0499990753739485No Hit
AACATTCAACGCTGTCGGTGA1662491.0421569927274243No Hit
TATTGCACTTGTCCCGGCCTGT1627121.0199847734462442No Hit
TTCACGTAATCCAGGATAGGCT1275060.799290639430631No Hit
TTGGTCCCCTTCAACCAGCTGT1236440.7750811085106657No Hit
TTCACAGTGGTTAAGTTCTG1202040.7535169483955231No Hit
ACAGTAGTCTGCACATTGGTT1094630.6861853658964688No Hit
TTCACAGTGGCTAAGTTCTG949440.5951708191779354No Hit
CCTTTCTGAGGGTCGCT913800.5728293463144563No Hit
ATGACCTATGAATTGACAGCC837270.5248553587094602No Hit
CTACGCCTGTCTGAGGGTCGCT828580.5194079008199082No Hit
TTAGGTAGTAGGTTGTATAGTT826310.5179849169983567No Hit
AACTCCAGTCACGGCTACATCT793910.49767448712246654Illumina PCR Primer Index 11 (100% over 22bp)
CTGTCTGAGGGTCGCT773450.48484882677491375No Hit
ACCCTGTAGAACCGAATTTGCG744490.4666948129105379No Hit
AAGCTGCCAGCTGAAGAACT738050.4626578015401449No Hit
TTCAAGTAATCCAGGATAGGTT734410.46037601250470545No Hit
TTTGGTCCCCTTCAACCAGCTGT729340.45719780634820034No Hit
TGATGTAGTAGGTTGTATAGTT710610.445456622657601No Hit
TTCACAGTGGCTAAGTTCTGC710120.4451494587489841No Hit
TAACGGAACCCATAATGCAGCTG672810.42176112113572917No Hit
TTCACAGTGGCTAAGTTCAGT665660.4172790355304015No Hit
TCCTTCATTCCACCGGAGTCT660460.4140193369083451No Hit
ATGACCTATGAATTGACAGCCA634140.39752024695978255No Hit
TTCAGTCATTGTTTCTGGTTGT554850.3478161116246181No Hit
TTGTTCCCCTTCAACCAGCTGT551350.3456220837059263No Hit
TTCAAGTAATCCAGGATAGGC548260.3436850704862812No Hit
TAGCTTATCAGACTGGTGTTGG521320.32679732416355034No Hit
ACATTAGTCTGCACATTGGTT516870.3240077743812136No Hit
TACCCTGTAGATCCGGATTTGT490800.3076654007125576No Hit
AACTCCAGTCACGGCTACATCTCG476610.2987701846650613Illumina PCR Primer Index 11 (100% over 24bp)
CCACGTTCCCGTGG475600.29813705089423875No Hit
AAGCTGCCAGCTGAAGAACTGC464100.290928102018537No Hit
TTATGTAGTAGGTTGTATAGTT460080.2884081042376396No Hit
TTCAAGTAATCCAGGATAGGCTT454380.28483497305577No Hit
AACTCCAGTCACGGCTACATCTCGTATGC427460.26795976403543165Illumina PCR Primer Index 11 (100% over 29bp)
TGAGGTAGTAGTTTGTATAGTT413930.2594782789668887No Hit
TACAGTAGTCTGCACATTGGTT413240.2590457420343466No Hit
AACTCCAGTCACGGCTACATCTC411670.2580615637965334Illumina PCR Primer Index 11 (100% over 23bp)
TGTCTGAGGGTCGCT407680.25556037196922465No Hit
TACCATGTAGAACCGAATTTGT399060.2501567946380465No Hit
TTCCCTTTGTCATCCTATGCCTG378440.23723083587135352No Hit
TTCCATTTGTCATCCTATGCCT374450.2347296440440448No Hit
CATTGCACTTGTCTCGGTCTGA373390.23406516701724098No Hit
TTCACAGTGGTTAAGTTCTGCC350640.21980398554574407No Hit
TGAGGTAGTAGGTTGTATAGT346950.21749085325432327No Hit
TACCCTGTAGAACCGAATTTG331970.20810041376232222No Hit
TATTGCACTTGTCCCGGCCTGTT331640.20789354827284554No Hit
TTCACAGTGGTTAAGTTCTGC329490.20654578826564915No Hit
ACAGTAGTCTGCACATTGGTTA300220.18819744621418916No Hit
AACATTCATTGCTGTCGGTGGG298390.18705028304527313No Hit
AACATTCATTGCTGTCGGTGGGT291030.182436555764824No Hit
TGAGGTAGTAGGTTGTATAGTTT286730.1797410357504312No Hit
TCCAGCATCAGTGATTTTGTT284830.17854999202314134No Hit
TTTTGTCCCCTTCAACCAGCTGT266450.1670282111244111No Hit
CACCACGTTCCCGTGG257940.1616935889563918No Hit
ACCCTGTAGAACCGAATTTGTG253350.1588162780573074No Hit
TACCCTGTAGAACCGAATGTGT250790.1572115033510642No Hit
TCCAGCATCAGTGATTTTGTTG243160.15242852248831604No Hit
TATGTGCCCTTGGACTACATCG227200.14242375517908126No Hit
AACATTAAGAGTTTATGTGCTG224090.14047420465704366No Hit
TGAGATGAAGCACTGTAGCTCT223770.14027360781876327No Hit
TTCCAGTGATGACAGCCTATAATCTGACT219970.13789152036418356No Hit
TTCAGGTAATCCAGGATAGGCT217500.13634316351870673No Hit
CATTATTACTTTTGGTACGCG204920.1284572003138087No Hit
TACCATGTAGAACCGAATTTGC203640.1276548129606871No Hit
TTTCTGAGGGTCGCT202490.1269339180731169No Hit
TACAGTACTGTGATAACTGAAG201580.12636347081425706No Hit
AACATTCAACGCTGTCGGTGAGA201480.1263007843022944No Hit
TTTGGTCCCCTTCAACCAGCTG200080.12542317313481768No Hit
AACCCGTAGATCCGAACTTGTG195570.12259601144530335No Hit
TTCAAGTAATCCAGGATGGGCT195390.12248317572377064No Hit
AACATTCAACGCTGTCGGTGG193490.12129213199648077No Hit
TGAGATGAAGCACTGTAGCTC192320.1205586998065181No Hit
TTCACAGTGGTTAAGTTCTGCCT191750.12020138668833112No Hit
ACCCTGTAGAACCGAATTTGC189210.11860914928448049No Hit
TGAGGTAGTAGATTGAATAGTT182630.11448437679733985No Hit
TATTGCACTTGTCCCGGCCTGTAT182180.11420228749350803No Hit
TTCACAGTGGCTAAGTTCTGCT178300.11177005082935823No Hit
ACCCTGTAGAACCGAATTTGT176860.11086736505709643No Hit
TCCCTGAGACCCTTAACCTGTG175910.11027184319345153No Hit
ACCACGTTCCCGTGG174770.1095572169570776No Hit
AACACTCAACGCTGTCGGTGAG173110.10851662085849804No Hit
CACGTTCCCGTGG172160.10792109899485312No Hit
TATTGCACTTGTCCCGGCCTGTTT171560.10754497992307738No Hit
TATTGCACTTGTCCCGGCCTGTA168320.10551393693548838No Hit
TACCATGTAGAACCGAATTTGCG168200.1054387131211332No Hit
TGGACGGAGAACTGATAAGGGC165830.10395304278761903No Hit
TCCAGTGATGACAGCCTATAATCTGACT164590.10317573003928251No Hit
TGTAAACATCCTTGACTGGAAGCT164550.10315065543449746No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTCTTGC50.0033428091564.869523
CGTATGC46800.01503.010323
AATAACC1850.01268.813123
GATTCCT11400.01262.877123
TAACTGC3100.0933.873723
TAACTAA950.0905.977123
TCGTATG48350.0874.3896522
ATAACTA10400.0857.1997722
ACAACCC5500.0768.6679722
GGATTCC15950.0754.838922
TAATAAC2850.0693.325622
TCTGACT66900.0663.1398323
CGTATAC605.456968E-12652.0289323
CTCGTAT65400.0621.175321
GACAACC9750.0550.5074521
GATAAAA4700.0549.5923521
TTCTCGC14000.0530.9378723
CGATAAA11650.0523.5641520
TAAAAAA457.420731E-7521.6231723
TCTCGTA72350.0511.3328220