FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_12_JG13_5_GTAGAG_L006_R1_001_TRIMMED_prinseq_good_Cto_.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_12_JG13_5_GTAGAG_L006_R1_001_TRIMMED_prinseq_good_Cto_.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15269022
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT11322687.415458567025446No Hit
AACATTCAACGCTGTCGGTGAG7639365.003175710926345No Hit
AACATTCAACGCTGTCGGTGAGT7336864.80506217097598No Hit
TCCTTCATTCCACCGGAGTCTG5614073.6767711776170082No Hit
AAGCTGCCAGCTGAAGAACTGT4070302.665724104661058No Hit
TTCCCTTTGTCATCCTATGCCT4006922.624215224786499No Hit
TGAGGTAGTAGGTTGTATAGTT3907292.5589654661575576No Hit
TACCCTGTAGAACCGAATTTGT3368272.20595006019377No Hit
CCTGTCTGAGGGTCGCT3260562.135408541555576No Hit
TAGCTTATCAGACTGGTGTTGGC3148922.0622931842000094No Hit
AACATTCAACGCTGTCGGTGA2771901.8153749467385665No Hit
TATTGCACTTGTCCCGGCCTGT2694981.76499843932375No Hit
TCCTTCATTCCACCGGAGTCTGT2672651.75037405801105No Hit
AACAGTAAGAGTTTATGTGCTG2163191.4167181106949744No Hit
TTGGTCCCCTTCAACCAGCTGT1961321.2845092501667756No Hit
TACCCTGTAGAACCGAATTTGC1925991.2613708985421594No Hit
ACAGTAGTCTGCACATTGGTT1717131.1245841416693225No Hit
TACCCTGTAGAACCGAATTTGCG1472280.9642267854483411No Hit
TTTGGTCCCCTTCAACCAGCTGT1444430.945987241357043No Hit
AACTCCAGTCACGTAGAGATCTCGTATGC1420980.9306293487559322RNA PCR Primer, Index 17 (100% over 29bp)
TTCCCTTTGTCATCCTATGCCTG1048910.6869529692209495No Hit
TTCACAGTGGCTAAGTTCTG990660.6488038330156313No Hit
AAGCTGCCAGCTGAAGAACT944420.6185202955369374No Hit
TTCACAGTGGTTAAGTTCTG876590.57409701813253No Hit
CTACGCCTGTCTGAGGGTCGCT806670.5283049562702837No Hit
TTCAAGTAATCCAGGATAGGC777950.5094956310888804No Hit
TGAGGTAGTAGGTTGTATAGT759060.4971241773048726No Hit
CACCACGTTCCCGTGG734010.48071841143460264No Hit
TTCAAGTAATCCAGGATAGGTT729470.47774507103336417No Hit
TAACGGAACCCATAATGCAGCTG708670.46412271853429776No Hit
CTGTCTGAGGGTCGCT700000.45844455525704264No Hit
ACCCTGTAGAACCGAATTTGCG699100.4578551265431407No Hit
AAGCTGCCAGCTGAAGAACTGC659990.4322411743201366No Hit
TTCACAGTGGCTAAGTTCTGC645950.4230460863832667No Hit
CCACGTTCCCGTGG602690.39471421286838154No Hit
TTCACAGTGGCTAAGTTCAGT585010.38313521324417504No Hit
TATTGCACTTGTCCCGGCCTGTT562410.3683340033173048No Hit
TTCAAGTAATCCAGGATAGGCTT533600.34946573526451136No Hit
TGAGGTAGTAGTTTGTATAGTT526300.3446848134739737No Hit
TCCTTCATTCCACCGGAGTCT524020.34319159406542216No Hit
TGTCTGAGGGTCGCT488350.3198305693711097No Hit
TATGTGCCCTTGGACTACATCG480910.31495795866952053No Hit
TGAGGTAGTAGGTTGTATAGTTT471620.30887374450046634No Hit
AACATTCAACGCTGTCGGTGG454240.2974912211142272No Hit
TGAGGTAGTAGATTGAATAGTT440170.28827648555356067No Hit
TGAGATGAAGCACTGTAGCTC438880.2874316377303013No Hit
CATTGCACTTGTCTCGGTCTGA437460.28650165020392265No Hit
AACATTCAACGCTGTCGGTGAGA425630.2787539372200787No Hit
TACAGTAGTCTGCACATTGGTT423980.2776733179112585No Hit
TGAGATGAAGCACTGTAGCTCT416740.27293169136831424No Hit
AACATTCATTGCTGTCGGTGGGT414320.2713467830487113No Hit
TGGACGGAGAACTGATAAGGGC389980.25540601094163073No Hit
ACAGTAGTCTGCACATTGGTTA381350.24975404449610458No Hit
AACTCCAGTCACGTAGAGATCT369830.24220935695816012RNA PCR Primer, Index 17 (100% over 22bp)
ACCACGTTCCCGTGG367320.240565505767167No Hit
TTCACAGTGGTTAAGTTCTGCC366440.2399891754691296No Hit
TTTGGTCCCCTTCAACCAGCTG360590.23615788882876718No Hit
ATGACCTATGAATTGACAGCC349510.22890136643984138No Hit
TACCCTGTAGAACCGAATTTG341820.22386502553994617No Hit
AACATTCATTGCTGTCGGTGGG338380.22161209801125442No Hit
TAGCTTATCAGACTGGTGTTGG331140.21687047146831012No Hit
CACGTTCCCGTGG320600.2099676063077255No Hit
TTCAGTCATTGTTTCTGGTTGT310070.20307129035507318No Hit
TATTGCACTTGTCCCGGCCTGTA291590.19096835409628726No Hit
TATTGCACTTGTCCCGGCCTGTAT285840.18720255953524725No Hit
TTCCAGTGATGACAGCCTATAATCTGACT280520.18371838091529372No Hit
TATTGCACTTGTCCCGGCCTGTTT271570.17785683981593584No Hit
ATGACCTATGAATTGACAGCCA268650.17594447109972072No Hit
TTCACAGTGGCTAAGTTCTGCT263380.17249303851942843No Hit
TGTAAACATCCTTGACTGGAAGCT246380.16135938503461453No Hit
TCCAGCATCAGTGATTTTGTT242720.15896237493141344No Hit
TCCCTGAGACCCTTAACCTGTG240540.15753464760218436No Hit
TCCCTGAGACCCTTAACCTGTGA239140.15661775849167026No Hit
AGCTACATCTGGCTACTGGGTCTC235310.154109411853621No Hit
TTCACGTAATCCAGGATAGGCT233340.15281921789096906No Hit
TTCACAGTGGTTAAGTTCTGC231040.15131290006655307No Hit
AACATTCAACGCTGTCGGTG231030.15130635085862082No Hit
CCTTTCTGAGGGTCGCT229500.15030432204498756No Hit
AACTCCAGTCACGTAGAGATCTCG228040.14934813768688002RNA PCR Primer, Index 17 (100% over 24bp)
ACCCTGTAGAACCGAATTTGTG227020.14868011847779117No Hit
TTCACAGTGGTTAAGTTCTGCCT222560.1457591717400106No Hit
AACCCGTAGATCCGAACTTGTG221900.1453269240164825No Hit
TACCCTGTAGATCCGGATTTGT217980.1427596345070431No Hit
TCCAGTGATGACAGCCTATAATCTGACT213780.14000896717550085No Hit
TGTAAACATCCCCGACTGGAAGCT207720.13604014716856128No Hit
TTCAAGTAATCCAGGATGGGCT206920.1355162105339818No Hit
AACTCCAGTCACGTAGAGATCTC203490.1332698322132223RNA PCR Primer, Index 17 (100% over 23bp)
TGTAAACATCCTACACTCTCAGCT199610.13072873953551184No Hit
TCCAGCATCAGTGATTTTGTTG190810.12496543655513759No Hit
TGAGAACTGAATTCCATAGATGG182410.11946410189205307No Hit
TGAGATGAAGCACTGTAGCT181540.11889432080194788No Hit
TTAGGTAGTAGGTTGTATAGTT181400.11880263189089647No Hit
TGTAAACATCCCCGACTGGA180650.11831144129597823No Hit
TCACAGTGAACCGGTCTCTTT179000.11723082198715805No Hit
TGAGGTAGTTGGTTGTATAGTT177730.11639907257976313No Hit
ACCCTGTAGAACCGAATTTGC176170.11537739614233314No Hit
CCCAGTGTTCAGACTACCTGTT175530.11495824683466957No Hit
CCCTGAGACCCTTAACCTGTGA172130.1127315161377068No Hit
TGTAAACATCCCCGACTGGAAGC172100.11271186851391005No Hit
TACGCCTGTCTGAGGGTCGCT171220.11213553821587265No Hit
GAGAGAGGCATGATCGTAGCGATAACTA170160.11144132217505484No Hit
TGAGGTAGTAGTTTGTGCTGTT167520.10971233128094254No Hit
CCCAGTGTTCAGACTACCTGT164860.1079702419709658No Hit
TAGCAGCACGTAAATATTGGAG160690.10523922226322027No Hit
TCCCTGAGACCCTAACTTGTGA155800.1020366595843532No Hit
ACCCTGTAGAACCGAATTTGT155580.10189257700984386No Hit
CTGGACAACTCTTAGCGG153730.1006809735423788No Hit
CATTATTACTTTTGGTACGCG153070.10024872581885075No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC158200.0796.02523
TAACTAA2600.0714.3356323
GATTCCT5600.0591.212523
GTATGCC2400.0571.9861523
ATAACTA21150.0541.727222
CGTATTC151.3955968E-4538.3398423
TCGTATG161100.0537.5830722
CGCGTAT102.5409923E-4440.811321
AATAACC550.0440.459923
ATAAAAA2450.0426.1597622
ATAAACC400.0412.141422
CAACCCG2950.0410.5981823
CTCGTAT179050.0409.2983721
ACAACCC5850.0408.618822
GGATTCC7400.0404.7153622
ACGGCTA203.3050124E-4403.7548823
GATAAAA8250.0395.3943521
TAAAAAA850.0380.0046423
AAATAGC1600.0378.520223
CGATAAA16200.0376.1737420