FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_12_JG14_5_GTGGCC_L004_R1_001_TRIMMED_prinseq_good_yoFr.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_12_JG14_5_GTGGCC_L004_R1_001_TRIMMED_prinseq_good_yoFr.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13316531
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC160567712.057772403338376No Hit
ATGACCTATGAATTGACAGCCA9415017.070167147885586No Hit
TTCAAGTAATCCAGGATAGGCT7189355.398815952893438No Hit
AACATTCAACGCTGTCGGTGAG5704814.28400609738377No Hit
TACCCTGTAGAACCGAATTTGT4516073.3913261644492847No Hit
AACATTCAACGCTGTCGGTGAGT3919712.9434918147977127No Hit
TAGCTTATCAGACTGGTGTTGGC2944162.210906128630647No Hit
TTCCCTTTGTCATCCTATGCCT2862162.1493285300803944No Hit
TACCCTGTAGAACCGAATTTGC2295601.7238723808775724No Hit
TACCCTGTAGAACCGAATTTGCG2164551.625460865145735No Hit
AAGCTGCCAGCTGAAGAACTGT2023061.5192094697935972No Hit
AACAGTAAGAGTTTATGTGCTG1852771.3913308203164922No Hit
TGAGGTAGTAGGTTGTATAGTT1763071.3239709350731057No Hit
TCCTTCATTCCACCGGAGTCTG1627191.2219323485973936No Hit
TTCACAGTGGTTAAGTTCTG1368061.0273396277153561No Hit
TTGGTCCCCTTCAACCAGCTGT1365141.0251468644499082No Hit
TGAGATGAAGCACTGTAGCTC1240080.9312335171975343No Hit
TGAGATGAAGCACTGTAGCTCT1225300.9201345305320132No Hit
CCTGTCTGAGGGTCGCT1096260.8232324169109808No Hit
ACCCTGTAGAACCGAATTTGCG913560.6860345235557218No Hit
TTCACAGTGGCTAAGTTCTG863260.648261923469408No Hit
AACATTCAACGCTGTCGGTGA848200.6369526718332275No Hit
TGAGATGAAGCACTGTAGCT758610.569675390685457No Hit
TTTGGTCCCCTTCAACCAGCTGT752630.5651847316692313No Hit
ATGACCTATGAATTGACAGCCT722840.5428140406837186No Hit
ACAGTAGTCTGCACATTGGTT681990.5121378833571597No Hit
TCCTTCATTCCACCGGAGTCTGT663570.49830545207306615No Hit
TAACGGAACCCATAATGCAGCTG623230.4680122773716368No Hit
TATTGCACTTGTCCCGGCCTGT621010.46634517653283725No Hit
TTCAAGTAATCCAGGATAGGTT523730.3932931181551712No Hit
AAGCTGCCAGCTGAAGAACT523290.3929627017727064No Hit
ATGACCTATGAATTGACAGCCAT496100.37254447122903106No Hit
TACCCTGTAGAACCGAATGTGT478170.3590800036435916No Hit
TTCACAGTGGCTAAGTTCTGC465130.34928766358145374No Hit
ATTACCTATGAATTGACAGCC464080.348499169941481No Hit
TTCAAGTAATCCAGGATAGGC443380.33295458103916103No Hit
ATGACCTATGAATTGACAGC432770.32498704054381733No Hit
AAGCTGCCAGCTGAAGAACTGC403680.3031420119849531No Hit
TACCCTGTAGATCCGGATTTGT387730.2911644181206051No Hit
TAGCTTATCAGACTGGTGTTGG373970.28083139670534313No Hit
AACTCCAGTCACGTGGCCATCTCGTATGC368970.27707666508642526TruSeq Adapter, Index 20 (96% over 29bp)
TTCACAGTGGTTAAGTTCTGCC339870.2552241270643233No Hit
TGTAACAGCAACTCCATGTGGA333780.2506508639524813No Hit
TTAGGTAGTAGGTTGTATAGTT330580.24824783571637388No Hit
TTCACAGTGGCTAAGTTCAGT322070.24185728250097566No Hit
ACCCTGTAGAACCGAATTTGTG303240.22771696322413096No Hit
TACCCTGTAGAACCGAATTTG295790.22212241311194333No Hit
TTAGATGAAGCACTGTAGCTC290140.21787956638256614No Hit
TTCAAGTAATCCAGGATAGGCTT288570.21670058065422593No Hit
TTAGATGAAGCACTGTAGCTCT288300.21649782514680435No Hit
TGAGGTAGTAGGTTGTATAGT285850.21465800665353463No Hit
TATGTGCCCTTGGACTACATCG282440.21209727968943262No Hit
ATGAACTATGAATTGACAGCC281240.21119614410089232No Hit
ATTACCTATGAATTGACAGCCA276030.20728371375397991No Hit
TGAGGTAGTAGTTTGTATAGTT256000.19224225888859495No Hit
AACATTAAGAGTTTATGTGCTG246400.18503317418027262No Hit
TTTGGTCCCCTTCAACCAGCTG244410.1835387909959433No Hit
TTCACAGTGGTTAAGTTCTGC237160.1780944301485124No Hit
TGAGGTAGTAGGTTGTATAGTTT237130.1780719017587989No Hit
TCCTTCATTCCACCGGAGTCT234590.17616449809638862No Hit
AACATTCATTGCTGTCGGTGGG232770.1747977757871025No Hit
TTCACAGTGGTTAAGTTCTGCCT232740.174775247397389No Hit
CATTGCACTTGTCTCGGTCTGA227910.17114817665351434No Hit
CTGTCTGAGGGTCGCT222600.16716065167422356No Hit
TTCCAGTGATGACAGCCTATAATCTGACT221640.16643974320339133No Hit
TTCACGTAATCCAGGATAGGCT219840.1650880398205809No Hit
TTCCCTTTGTCATCCTATGCCTG212700.15972628306876618No Hit
ACAGTAGTCTGCACATTGGTTA209360.15721812234732904No Hit
CTACGCCTGTCTGAGGGTCGCT205590.15438705470666497No Hit
CATTATTACTTTTGGTACGCG201810.15154847760276308No Hit
ACCCTGTAGAACCGAATTTGC194180.1458187571522944No Hit
TCCAGCATCAGTGATTTTGTT186260.1398712622679285No Hit
TTCAAGTAATCCAGGATGGGCT184840.13880491848815582No Hit
ACCCTGTAGAACCGAATTTGT181790.1365145322006159No Hit
TTAGATGAAGCACTGTAGCT177340.133172821059779No Hit
TACAGTAGTCTGCACATTGGTT176930.13286493306702776No Hit
AACCCGTAGATCCGAACTTGTG176140.13227168547123871No Hit
TGTAAACATCCTTGACTGGAAGCT171290.1286295958008884No Hit
TACCCTGTAGAACCGAATTTGTG169990.12765336557996973No Hit
AACATTCATTGCTGTCGGTGGGT169510.12729291134455362No Hit
TATTGCACTTGTCCCGGCCTGTT166470.12501003452025156No Hit
TTCAGTCATTGTTTCTGGTTGT164290.12337297153440337No Hit
CACCACGTTCCCGTGG163980.12314017817403047No Hit
AACATTCAACGCTGTCGGTGAGA161790.12149560572494442No Hit
AGGACCTATGAATTGACAGCC161760.12147307733523093No Hit
TTCACAGTGGCTAAGTTCTGCT161040.12093239598210674No Hit
ATGAACTATGAATTGACAGCCA159380.11968582508462602No Hit
ATAACCTATGAATTGACAGCC156630.11762072269422119No Hit
TGGACGGAGAACTGATAAGGGC151410.11370078288407094No Hit
TGAGAACTGAATTCCATAGATGG149780.11247674037630372No Hit
TCCAGCATCAGTGATTTTGTTG145160.10900736836042359No Hit
TTTAAGTAATCCAGGATAGGCT143100.10746041893342943No Hit
TCCAGTGATGACAGCCTATAATCTGACT142470.10698732274944578No Hit
ACCCTGTAGAACCGAATTTGTGT138890.10429893491030058No Hit
CCACGTTCCCGTGG135470.10173069848296076No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATTC103.5225803E-61835.935523
GCGACGC50.0024284391835.935523
TAGGTAC50.0024284391835.935523
TCATGCG50.0024284391835.935523
ATCGCCT50.0024284391835.935523
CGTATGC37850.01809.257623
TAACTAA400.01606.443623
AATAACC1100.01502.129223
TAACTGC2000.01422.8523
CAACCCG1050.01398.80823
AAATAGC1250.01248.436223
GCACGCA50.00636304361134.164822
TACGGGA50.00636304361134.164822
CCGAGAT50.00636304361134.164822
TTGCCGC50.00636304361134.164822
AATACTC101.4941821E-51134.164822
ACGACAT50.00636304361134.164822
GATTCCT5900.01104.673123
TCGTATG39350.01102.460122
GCTGAGC1850.01091.637323