FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_12_JG5_5_GTGAAA_L003_R1_001_TRIMMED_prinseq_good_UUvu.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_12_JG5_5_GTGAAA_L003_R1_001_TRIMMED_prinseq_good_UUvu.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20738307
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT13560906.539058371544022No Hit
AACATTCAACGCTGTCGGTGAG9248484.459611867063209No Hit
TTCCCTTTGTCATCCTATGCCT8079093.895732665159215No Hit
TACCCTGTAGAACCGAATTTGT7132183.439133194430963No Hit
AACATTCAACGCTGTCGGTGAGT6710953.2360163247655658No Hit
TGAGGTAGTAGGTTGTATAGTT6707033.234126102964914No Hit
AACAGTAAGAGTTTATGTGCTG5009982.415809545108962No Hit
TACCCTGTAGAACCGAATTTGC4509252.174357820047702No Hit
AAGCTGCCAGCTGAAGAACTGT4229552.0394866369757185No Hit
TCCTTCATTCCACCGGAGTCTG4135011.9938995020181736No Hit
TACCCTGTAGAACCGAATTTGCG3384841.6321679489073049No Hit
TAGCTTATCAGACTGGTGTTGGC3159631.5235718132632523No Hit
CCTGTCTGAGGGTCGCT3150061.5189571646325806No Hit
TTGGTCCCCTTCAACCAGCTGT2634861.270528013689835No Hit
TATTGCACTTGTCCCGGCCTGT2249881.0848908736860727No Hit
TTCACAGTGGTTAAGTTCTG1984330.9568428126751137No Hit
AACATTCAACGCTGTCGGTGA1966090.9480474949088177No Hit
TCCTTCATTCCACCGGAGTCTGT1965370.9477003113127799No Hit
TTTGGTCCCCTTCAACCAGCTGT1900630.9164827196356964No Hit
ACAGTAGTCTGCACATTGGTT1791420.8638217189088773No Hit
TTCACAGTGGCTAAGTTCTG1705020.8221596873843172No Hit
ACCCTGTAGAACCGAATTTGCG1542380.7437347706348449No Hit
TTCACGTAATCCAGGATAGGCT1260670.6078943666905885No Hit
TGAGGTAGTAGGTTGTATAGT1225270.5908245065520537No Hit
TGAGGTAGTAGTTTGTATAGTT1130240.5450010938694272No Hit
AAGCTGCCAGCTGAAGAACT1101600.5311909019381379No Hit
TTCACAGTGGCTAAGTTCTGC1035390.4992644770858103No Hit
TGAGGTAGTAGGTTGTATAGTTT988490.47664932339944627No Hit
TTCAAGTAATCCAGGATAGGTT970410.46793115754338094No Hit
TAGCTTATCAGACTGGTGTTGG941300.4538943318757891No Hit
TTCAAGTAATCCAGGATAGGC882900.42573388464159584No Hit
TTCACAGTGGCTAAGTTCAGT863710.4164804774083053No Hit
CTACGCCTGTCTGAGGGTCGCT851260.41047709439348157No Hit
TGATGTAGTAGGTTGTATAGTT836550.4033839406466497No Hit
TAACGGAACCCATAATGCAGCTG831100.40075595370441763No Hit
TTCAGTCATTGTTTCTGGTTGT817610.39425108327309455No Hit
TCCTTCATTCCACCGGAGTCT805640.3884791559889628No Hit
CTGTCTGAGGGTCGCT768160.37040632101742926No Hit
AACTCCAGTCACGTGAAAATCT714100.34433861934824284TruSeq Adapter, Index 19 (95% over 22bp)
TTCAAGTAATCCAGGATAGGCTT686900.33122279460902954No Hit
TGTCTGAGGGTCGCT675610.3257787629433782No Hit
AAGCTGCCAGCTGAAGAACTGC652200.31449047407775377No Hit
TCCAGCATCAGTGATTTTGTT624020.3009020938883777No Hit
CATTGCACTTGTCTCGGTCTGA606180.2922996558976584No Hit
TTTGGTCCCCTTCAACCAGCTG604700.2915860007280247No Hit
TATTGCACTTGTCCCGGCCTGTT589710.28435783113828916No Hit
TACCCTGTAGAACCGAATTTG579700.2795310147544831No Hit
TTCCAGTGATGACAGCCTATAATCTGACT574700.2771200175597748No Hit
TACCCTGTAGATCCGGATTTGT546760.26364736523574467No Hit
TTCCCTTTGTCATCCTATGCCTG541020.2608795404562195No Hit
TGAGATGAAGCACTGTAGCTCT531500.2562890017974948No Hit
AACTCCAGTCACGTGAAAATCTCGTATGC504640.24333712486752174TruSeq Adapter, Index 19 (96% over 29bp)
TACAGTAGTCTGCACATTGGTT499450.24083450977941448No Hit
TGAGATGAAGCACTGTAGCTC472220.22770421905703295No Hit
CCTTTCTGAGGGTCGCT468980.22614189287486194No Hit
TCCAGCATCAGTGATTTTGTTG468400.2258622172002758No Hit
TTCCATTTGTCATCCTATGCCT466530.22496050424945488No Hit
TCCAGTGATGACAGCCTATAATCTGACT466280.22483995438971946No Hit
AACTCCAGTCACGTGAAAATCTCG462560.22304617247685646TruSeq Adapter, Index 19 (95% over 24bp)
TTCACAGTGGTTAAGTTCTGCC458890.22127650053594058No Hit
TATGTGCCCTTGGACTACATCG456010.21988776615178857No Hit
TTCACAGTGGTTAAGTTCTGC448120.21608321257853882No Hit
ACCCTGTAGAACCGAATTTGTG443100.21366257139505168No Hit
ACAGTAGTCTGCACATTGGTTA436820.21063435891849805No Hit
TACCATGTAGAACCGAATTTGT427360.20607275222610985No Hit
TTAGGTAGTAGGTTGTATAGTT420970.20299149781127265No Hit
ACCCTGTAGAACCGAATTTGC411730.19853597499545164No Hit
TGAGGTAGTAGATTGAATAGTT395880.19089311388822627No Hit
TGTAAACATCCTTGACTGGAAGCT388650.18740681194467804No Hit
CATTATTACTTTTGGTACGCG374390.1805306479453699No Hit
TATTGCACTTGTCCCGGCCTGTAT374200.18043903005197098No Hit
TACAGTACTGTGATAACTGAAG362600.17484551656024766No Hit
TTGTTCCCCTTCAACCAGCTGT360860.17400648953648917No Hit
TATTGCACTTGTCCCGGCCTGTA355220.17128688470085818No Hit
TTTGGTCCCCTTCAACCAGCT350820.16916520716951486No Hit
AACTCCAGTCACGTGAAAATCTC334510.1613005343203763TruSeq Adapter, Index 19 (95% over 23bp)
TTCAAGTAATCCAGGATGGGCT330600.15941513451411438No Hit
ACCCTGTAGAACCGAATTTGT329150.158715945327649No Hit
TTCACAGTGGCTAAGTTCTGCT312790.15082716250656333No Hit
TACCCTGTAGAACCGAATGTGT312080.15048480090491476No Hit
TGGACGGAGAACTGATAAGGGC309570.14927448031317117No Hit
TGAGGTAGTTGGTTGTATAGTT308360.14869101899205175No Hit
TGAAATGTTTAGGACCACTTGT305870.147490342389087No Hit
TATTGCACTTGTCCCGGCCTGTTT303760.14647290157292012No Hit
AACCCGTAGATCCGAACTTGTG300590.14494432935147503No Hit
TTCACAGTGGTTAAGTTCTGCCT298420.1438979565689716No Hit
TGAGATGAAGCACTGTAGCT292690.1411349537838359No Hit
AACATTCATTGCTGTCGGTGGG285370.1376052538907829No Hit
AACATTCAACGCTGTCGGTGAGA273190.1317320647244734No Hit
TGAGAACTGAATTCCATAGATGG273020.13165009081985332No Hit
TGTAAACATCCTACACTCTCAGCT268590.12951394730534174No Hit
CCACGTTCCCGTGG266790.12864598831524676No Hit
TACCATGTAGAACCGAATTTGC262230.12644715887367278No Hit
ACATTAGTCTGCACATTGGTT261240.12596978142912052No Hit
TTTTGTCCCCTTCAACCAGCTGT254680.1228065531096632No Hit
GTACAGTACTGTGATAACTGA250010.12055468172980562No Hit
TCCCTGAGACCCTTAACCTGTG245560.11840889422651522No Hit
ATGACCTATGAATTGACAGCC241440.11642223253807554No Hit
TGTAAACATCCCCGACTGGA239690.11557838351992764No Hit
GTGAAATGTTTAGGACCACTTG229680.11075156713612157No Hit
AACATTCATTGCTGTCGGTGGGT227320.10961357646021924No Hit
TGTAAACATCCCCGACTGGAAGCT223130.10759316081105368No Hit
CCCAGTGTTCAGACTACCTGTT218660.10543772931898443No Hit
TACCCTGTAGAACCGAATTTGTG217220.10474336212690843No Hit
CATAAAGTAGAAAGCACTACT216330.10431420462625035No Hit
TTCAAGTAATCCAGGATAGGCA214380.1033739157203141No Hit
AACATTCAACGCTGTCGGTGG213660.1030267321242761No Hit
TGTAAACATCCTACACTCAGCT213270.10283867434308885No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC54600.01220.112423
TAACTAA2250.01005.556923
TAACTGC4150.0999.4992723
AATAACC3900.0950.766923
GTATGCC1500.0837.9640523
GATTCCT7150.0676.817123
ATAACTA23850.0672.788322
TCGTATG57500.0655.3429622
AAATAGC2150.0613.857423
TCTGACT133950.0597.272223
ACAACCC8350.0549.6408722
TAATAAC6450.0540.350422
GGATTCC8850.0471.7978822
GCCCCCC152.2348469E-4460.100422
GACAACC15050.0446.2434421
CTCGTAT85650.0438.324521
CGATAAA16100.0422.23520
CGATAAC61050.0420.0331720
GTACTCT4050.0418.9820323
GATAAAA8700.0417.0303621