FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_12_JG6_5_CCGTCC_L001_R1_001_TRIMMED_prinseq_good_Hd9l.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_12_JG6_5_CCGTCC_L001_R1_001_TRIMMED_prinseq_good_Hd9l.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16477741
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG11048136.704881451893193No Hit
TTCAAGTAATCCAGGATAGGCT9171025.565702240373847No Hit
AACATTCAACGCTGTCGGTGAGT6912144.194834716724823No Hit
TACCCTGTAGAACCGAATTTGT5447723.3061085254344027No Hit
TAGCTTATCAGACTGGTGTTGGC4321042.622349750490677No Hit
TTCCCTTTGTCATCCTATGCCT4208992.554348924406568No Hit
TACCCTGTAGAACCGAATTTGC4114782.4971748251171078No Hit
TCCTTCATTCCACCGGAGTCTG3295882.000201362553277No Hit
AACAGTAAGAGTTTATGTGCTG3158731.9169678659228833No Hit
AAGCTGCCAGCTGAAGAACTGT3103141.883231445378344No Hit
TACCCTGTAGAACCGAATTTGCG2785591.6905169221921863No Hit
TTCACAGTGGTTAAGTTCTG1979381.2012447580041463No Hit
TGAGGTAGTAGGTTGTATAGTT1833671.1128163745260955No Hit
TTGGTCCCCTTCAACCAGCTGT1584070.9613393000897393No Hit
AACATTCAACGCTGTCGGTGA1565520.9500816889888001No Hit
TTCACGTAATCCAGGATAGGCT1522950.9242468369905802No Hit
ACCCTGTAGAACCGAATTTGCG1374490.8341495354247891No Hit
TTCACAGTGGCTAAGTTCTG1248950.7579619075211826No Hit
TCCTTCATTCCACCGGAGTCTGT1248580.7577373621784685No Hit
TATTGCACTTGTCCCGGCCTGT1098210.6664809211408287No Hit
TACCCTGTAGATCCGGATTTGT999000.6062724253282049No Hit
CCTGTCTGAGGGTCGCT916810.556393015280432No Hit
ATGACCTATGAATTGACAGCC903550.5483457957010005No Hit
TTTGGTCCCCTTCAACCAGCTGT866070.5255999593633618No Hit
AAGCTGCCAGCTGAAGAACT750490.45545684933389835No Hit
TTCAAGTAATCCAGGATAGGTT728690.44222688049290254No Hit
TTGTTCCCCTTCAACCAGCTGT709350.4304898347413035No Hit
TAGCTTATCAGACTGGTGTTGG696450.4226610917115398No Hit
TTAGGTAGTAGGTTGTATAGTT684100.41516613229932425No Hit
ACAGTAGTCTGCACATTGGTT629400.38196983433590803No Hit
TTCACAGTGGCTAAGTTCTGC624280.3788626122961879No Hit
TTCAAGTAATCCAGGATAGGC577310.35035749135758354No Hit
TGATGTAGTAGGTTGTATAGTT570480.34621250570694123No Hit
TACCATGTAGAACCGAATTTGT561520.34077486713743105No Hit
ATGACCTATGAATTGACAGCCA552260.33515516477653096No Hit
TCCTTCATTCCACCGGAGTCT521760.31664534598522937No Hit
AAGCTGCCAGCTGAAGAACTGC512910.3112744641392288No Hit
TAACGGAACCCATAATGCAGCTG497730.3020620362949023No Hit
TTCACAGTGGCTAAGTTCAGT471180.28594939075690046No Hit
TTCCATTTGTCATCCTATGCCT469710.2850572781790902No Hit
AACTCCAGTCACCCGTCCATCTCGTATGC464480.2818832994158605TruSeq Adapter, Index 16 (96% over 29bp)
CATTGCACTTGTCTCGGTCTGA456050.27676730687780565No Hit
TACCATGTAGAACCGAATTTGC425890.25846382705007925No Hit
CCTTTCTGAGGGTCGCT422290.2562790615534011No Hit
TTCAAGTAATCCAGGATAGGCTT397080.24097963428360722No Hit
TACCCTGTAGAACCGAATTTG392100.2379573753465357No Hit
ACCCTGTAGAACCGAATTTGC385590.2340065910733759No Hit
TTATGTAGTAGGTTGTATAGTT381620.23159728023398352No Hit
TTCAGTCATTGTTTCTGGTTGT378350.22961278490783413No Hit
TTCACAGTGGTTAAGTTCTGCC377740.2292425885320081No Hit
TTTGGTCCCCTTCAACCAGCTG358800.21774829450226219No Hit
TTCAAGTAATCCAGGATGGGCT355810.21593372538140998No Hit
ACCCTGTAGAACCGAATTTGTG348930.21175839576553607No Hit
TCCAGCATCAGTGATTTTGTT341630.20732817684171634No Hit
TATGTGCCCTTGGACTACATCG325600.19759990158845198No Hit
TTCACAGTGGTTAAGTTCTGC323520.19633759263481565No Hit
AACTCCAGTCACCCGTCCATCT320500.19450481713482448TruSeq Adapter, Index 16 (95% over 22bp)
TTTTGTCCCCTTCAACCAGCTGT320310.19438951006694427No Hit
TGAGGTAGTAGGTTGTATAGT317540.1927084543931113No Hit
AACATTCATTGCTGTCGGTGGG314630.1909424356166297No Hit
CTACGCCTGTCTGAGGGTCGCT312970.1899350159709392No Hit
TACCCTGTAGAACCGAATGTGT301770.18313796775905145No Hit
CATTATTACTTTTGGTACGCG301540.1829983855189859No Hit
CTGTCTGAGGGTCGCT297870.18077113847098336No Hit
TGAGGTAGTAGTTTGTATAGTT292910.1777610171200045No Hit
ACATTAGTCTGCACATTGGTT292560.17754860936338301No Hit
TATTGCACTTGTCCCGGCCTGTT289010.17539418783193642No Hit
TTCACAGTGGTTAAGTTCTGCCT280480.1702175073634183No Hit
TACAGTAGTCTGCACATTGGTT279390.16955600892136852No Hit
TTCAGGTAATCCAGGATAGGCT277480.1683968694495198No Hit
TACCATGTAGAACCGAATTTGCG276120.16757151359521916No Hit
AACATTAAGAGTTTATGTGCTG275160.16698890946277162No Hit
TGAGATGAAGCACTGTAGCTC273640.1660664529197297No Hit
AACACTCAACGCTGTCGGTGAG271430.16472524965649116No Hit
TGAGATGAAGCACTGTAGCTCT271360.16468276810516685No Hit
ACCCTGTAGAACCGAATTTGT269840.16376031156212495No Hit
TCCAGCATCAGTGATTTTGTTG257600.156332108873419No Hit
TTCCAGTGATGACAGCCTATAATCTGACT251420.15258159477078806No Hit
TGAGGTAGTAGGTTGTATAGTTT243600.14783579860855928No Hit
AACATTCATTGCTGTCGGTGGGT239240.1451898048403601No Hit
AACATTCAACGCTGTCGGTGAGA238930.14500167225592392No Hit
TTCAAAGTGGTTAAGTTCTG210350.1276570617295174No Hit
CCACGTTCCCGTGG206300.12519920054575442No Hit
TGGACGGAGAACTGATAAGGGC205690.1248290041699284No Hit
TTCCCTTTGTCATCCTATGCCTG202540.12291733436033496No Hit
TACAGTACTGTGATAACTGAAG199240.12091463265504658No Hit
TTCACAGTGGCTAAGTTCTGCT198200.12028347817822843No Hit
AACCCGTAGATCCGAACTTGTG197290.11973121801101255No Hit
TATTGCACTTGTCCCGGCCTGTA189710.11513107288189564No Hit
TCCAGTGATGACAGCCTATAATCTGACT188920.11465163823123571No Hit
ACAGTAGTCTGCACATTGGTTA184700.11209060756568513No Hit
TACCCTGTAGATCCGGATTTGTG181520.1101607313769527No Hit
CCCAGTGTTCAGACTACCTGTT179640.10901979828424296No Hit
AACAATCAACGCTGTCGGTGAG173440.10525714659551937No Hit
AACACTAAGAGTTTATGTGCTG170980.1037642235061226No Hit
ACCCTGTAGAACCGAATTTGTGT168720.10239267627765239No Hit
TGAGATGAAGCACTGTAGCT167130.10142773818328617No Hit
TATTGCACTTGTCCCGGCCTGTAT167110.10141560059719351No Hit
AACACTCAACGCTGTCGGTGAGT166550.10107574818659913No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCTAGCA50.00286582441690.106923
CGTATGC44950.01654.387223
AATAACC1450.01165.59123
TAACTGC2850.01156.38923
AAATAGC2000.01098.569623
CGCAATT50.0086464975972.93922
TCGTATG46150.0943.42422
ATAACTA10700.0909.288822
GATTCCT6550.0864.405823
CGTATCC700.0845.0534723
TCTGACT66300.0838.680523
TAACTAA1050.0804.812823
GCTGAGC3400.0795.344523
ACAACCC2300.0761.4305422
TCTGAGA24950.0687.5585323
ACCACAC257.047759E-5676.0428523
CTCGTAT61450.0629.442921
GGATTCC9650.0625.100722
CGATAAC27950.0609.890520
TCTCGTA58200.0595.095220