FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_12_JG7_5_GTCCGC_L002_R1_001_TRIMMED_prinseq_good_jPAw.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_12_JG7_5_GTCCGC_L002_R1_001_TRIMMED_prinseq_good_jPAw.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8851300
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT6681197.548258447911606No Hit
AACATTCAACGCTGTCGGTGAG6486067.32780495520432No Hit
AACATTCAACGCTGTCGGTGAGT3973314.48895642448002No Hit
TTCCCTTTGTCATCCTATGCCT3806284.300249680837843No Hit
TACCCTGTAGAACCGAATTTGT3051083.4470416774937016No Hit
TACCCTGTAGAACCGAATTTGC2130302.4067651079502443No Hit
TCCTTCATTCCACCGGAGTCTG2037152.3015263294657284No Hit
TAGCTTATCAGACTGGTGTTGGC1983692.241128421813745No Hit
TACCCTGTAGAACCGAATTTGCG1783512.014969552495114No Hit
AAGCTGCCAGCTGAAGAACTGT1641911.8549930518680873No Hit
AACAGTAAGAGTTTATGTGCTG1440301.6272186006575304No Hit
AACATTCAACGCTGTCGGTGA910931.0291482607074667No Hit
TTCACGTAATCCAGGATAGGCT899121.0158055878797465No Hit
TCCTTCATTCCACCGGAGTCTGT892381.0081908872143075No Hit
ACCCTGTAGAACCGAATTTGCG851770.9623106210387175No Hit
TTGGTCCCCTTCAACCAGCTGT768710.8684712980014235No Hit
TACCCTGTAGATCCGGATTTGT742680.8390631884581926No Hit
TGAGGTAGTAGGTTGTATAGTT700950.7919175714301854No Hit
TATTGCACTTGTCCCGGCCTGT683900.7726548642572277No Hit
TTCACAGTGGCTAAGTTCTG664980.7512794730717521No Hit
TAACGGAACCCATAATGCAGCTG563010.6360760566244507No Hit
TTTGGTCCCCTTCAACCAGCTGT556140.6283144848779275No Hit
CCTGTCTGAGGGTCGCT541660.6119553060002485No Hit
TTCACAGTGGTTAAGTTCTG508800.5748308158123666No Hit
AAGCTGCCAGCTGAAGAACT460200.5199236270378362No Hit
TTCAAGTAATCCAGGATAGGC440110.4972263961226035No Hit
AACTCCAGTCACGTCCGCATCTCGTATGC367960.4157129461209088TruSeq Adapter, Index 18 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTT363410.4105724582829641No Hit
ACAGTAGTCTGCACATTGGTT355430.40155683345949184No Hit
CATTGCACTTGTCTCGGTCTGA340960.3852089523572808No Hit
TTCACAGTGGCTAAGTTCTGC325330.3675505293007807No Hit
TTCCATTTGTCATCCTATGCCT320760.3623874459118999No Hit
AAGCTGCCAGCTGAAGAACTGC320200.3617547704856914No Hit
TTGTTCCCCTTCAACCAGCTGT279230.31546778439325296No Hit
TACCATGTAGAACCGAATTTGT269690.30468970659677114No Hit
TTCAAGTAATCCAGGATAGGCTT258290.29181024256323934No Hit
TCCTTCATTCCACCGGAGTCT239710.2708189757436761No Hit
TTCCCTTTGTCATCCTATGCCTG238620.26958751821766297No Hit
ACCCTGTAGAACCGAATTTGTG231350.2613740354524194No Hit
TATGTGCCCTTGGACTACATCG230790.26074136002621084No Hit
TTCCAGTGATGACAGCCTATAATCTGACT227830.25739721848767977No Hit
TTCACAGTGGCTAAGTTCAGT226110.25545400110718197No Hit
CCTTTCTGAGGGTCGCT222790.2517031396518026No Hit
TACCCTGTAGAACCGAATTTG213810.2415577372815293No Hit
TTTTGTCCCCTTCAACCAGCTGT204830.23141233491125596No Hit
ACCCTGTAGAACCGAATTTGC198070.223775038694881No Hit
TATTGCACTTGTCCCGGCCTGTT198050.22375244314394496No Hit
TAGCTTATCAGACTGGTGTTGG196170.221628461355959No Hit
TTAGGTAGTAGGTTGTATAGTT182800.20652333555522917No Hit
AACATTCATTGCTGTCGGTGGG181970.20558562019138432No Hit
TACCATGTAGAACCGAATTTGC180110.20348423395433438No Hit
TTCACAGTGGTTAAGTTCTGCC179570.2028741540790618No Hit
TCCAGTGATGACAGCCTATAATCTGACT179190.20244483861127743No Hit
TTTGGTCCCCTTCAACCAGCTG177230.20023047461954743No Hit
TGAGATGAAGCACTGTAGCTC172990.19544021782111104No Hit
TTATGTAGTAGGTTGTATAGTT164460.1858032153468982No Hit
CATTATTACTTTTGGTACGCG161150.18206365166698676No Hit
TGAGATGAAGCACTGTAGCTCT159520.1802221142657011No Hit
AACATTCAACGCTGTCGGTGAGA158440.17900195451515596No Hit
AACACTCAACGCTGTCGGTGAG158150.17867431902658368No Hit
CTACGCCTGTCTGAGGGTCGCT154970.17508162642775638No Hit
TACCATGTAGAACCGAATTTGCG152370.1721442048060737No Hit
TGATGTAGTAGGTTGTATAGTT150860.17043824071040412No Hit
TTCACAGTGGTTAAGTTCTGCCT149240.16860800108458646No Hit
CCCAGTGTTCAGACTACCTGTT145540.16442782416142263No Hit
ACCCTGTAGAACCGAATTTGT143070.16163727362082406No Hit
TACAGTAGTCTGCACATTGGTT142950.16150170031520794No Hit
AACATTCAACGCTGTCGGTGG141550.1599200117496865No Hit
AACATTCATTGCTGTCGGTGGGT137380.15520883937952618No Hit
TACCCTGTAGAACCGAATGTGT137370.15519754160405816No Hit
TCCCTGAGACCCTTAACCTGTG135490.1530735598160722No Hit
ACATTAGTCTGCACATTGGTT133920.1512998090675946No Hit
TTCAAGTAATCCAGGATGGGCT133680.15102866245636234No Hit
TGGACGGAGAACTGATAAGGGC132720.14994407601143336No Hit
TCCAGCATCAGTGATTTTGTT132110.1492549117078847No Hit
AACCCGTAGATCCGAACTTGTG131820.14892727621931243No Hit
GAATACCAGGTGCTGTAAGCTT129570.14638527673901008No Hit
TTCACAGTGGCTAAGTTCTGCT129460.14626100120886198No Hit
TCCAGCATCAGTGATTTTGTTG128560.14524420141674105No Hit
TATTGCACTTGTCCCGGCCTGTA125670.14197914430648606No Hit
TGAGGTAGTAGGTTGTATAGT125350.14161761549150972No Hit
TACCCTGTAGATCCGGATTTGTG122110.13795713623987435No Hit
TATTGCACTTGTCCCGGCCTGTAT117570.13282794617739765No Hit
TGAGATGAAGCACTGTAGCT115830.13086213324596385No Hit
CACCACGTTCCCGTGG112080.12662546744546No Hit
TCCCTGAGACCCTTAACCTGTGA109260.12343949476348107No Hit
CTGTCTGAGGGTCGCT107990.12200467727904375No Hit
TGTAAACATCCCCGACTGGA106940.12081841085490266No Hit
TGAGGTAGTAGGTTGTATAGTTT102600.11591517630178617No Hit
TACCCTGTAGAACCGAATTTGTG100630.11368951453458813No Hit
TTCAGTCATTGTTTCTGGTTGT98520.11130568391083796No Hit
TTCAGGTAATCCAGGATAGGCT98410.11118140838068985No Hit
CCACGTTCCCGTGG97280.10990475975280467No Hit
AACACTCAACGCTGTCGGTGAGT96900.10947544428502028No Hit
TGCAAGTAATCCAGGATAGGCT96190.10867330222679154No Hit
CCCAGTGTTCAGACTACCTGTTC95780.10821009343260311No Hit
GAGAGAGGCATGATCGTAGCGATAACTA95370.10774688463841471No Hit
ACCCTGTAGAACCGAATTTGTGT94340.10658321376520964No Hit
TCCCTGAGACCCTAACTTGTGA92600.10461740083377583No Hit
ACAGTAGTCTGCACATTGGTTA91170.10300181894185034No Hit
TGAGGTAGTAGTTTGTATAGTT91030.10284365008529821No Hit
TTCACAGTGGTTAAGTTCTGC90830.102617694575938No Hit
CCCTGAGACCCTTAACCTGTGA90140.1018381480686453No Hit
CTTCCCTTTGTCATCCTATGCCT90000.10167997921209314No Hit
AACATTCAACGCTGTCGGTGT89460.10106989933682058No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATAC250.01036.334623
CGTATGC42000.01010.426323
AATAACC1000.0880.884423
TAACTGC2600.0777.250923
AAATAGC1350.0729.2724623
GATTCCT4000.0725.434223
TAACTAA500.0725.434223
TCGTATG42750.0587.957222
ATAACTA12100.0587.059322
TCTGACT54150.0566.491223
GTACTCT1200.0561.347923
TAAAAAA307.6181277E-7518.167323
GATGCAC201.5639196E-4518.167323
TAATAAC1400.0477.0305222
ACAACCC1900.0463.3358822
GGATTCC6150.0449.1772822
CTCGTAT47300.0440.4048221
GATAACA3150.0432.6302521
GATAAAA3100.0416.0577421
CGTATCC501.1288648E-8414.5338423