FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_14_JG66_5_GTTTCG_L001_R1_001_TRIMMED_prinseq_good_dyeo.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_14_JG66_5_GTTTCG_L001_R1_001_TRIMMED_prinseq_good_dyeo.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13218557
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT6727125.089148535653324No Hit
AACATTCAACGCTGTCGGTGAG5669414.2889779875367635No Hit
AACATTCAACGCTGTCGGTGAGT4416813.3413707714087098No Hit
TCCTTCATTCCACCGGAGTCTG4068313.0777262601356563No Hit
TTCCCTTTGTCATCCTATGCCT3351032.5350951696164716No Hit
TACCCTGTAGAACCGAATTTGT3070202.322643840776266No Hit
AAGCTGCCAGCTGAAGAACTGT2705202.046516877749969No Hit
AACAGTAAGAGTTTATGTGCTG2539561.9212081923919533No Hit
TAGCTTATCAGACTGGTGTTGGC2290911.73310142703171No Hit
TGAGGTAGTAGGTTGTATAGTT1992571.507403569088517No Hit
TCCTTCATTCCACCGGAGTCTGT1821811.378221541125858No Hit
TACCCTGTAGAACCGAATTTGC1632321.2348700391426992No Hit
CCTGTCTGAGGGTCGCT1571131.1885790559438523No Hit
TACCCTGTAGAACCGAATTTGCG1248720.9446719486854729No Hit
TATTGCACTTGTCCCGGCCTGT1244460.9414492065964538No Hit
AACATTCAACGCTGTCGGTGA1155000.8737716227270496No Hit
TTGGTCCCCTTCAACCAGCTGT1137760.8607293519254787No Hit
TTCACAGTGGTTAAGTTCTG981950.742857181763486No Hit
TTCACGTAATCCAGGATAGGCT949210.7180889714361409No Hit
ACAGTAGTCTGCACATTGGTT930740.7041161905947828No Hit
TTCACAGTGGCTAAGTTCTG888560.6722065048401275No Hit
TTTGGTCCCCTTCAACCAGCTGT738470.5586615846192591No Hit
CCTTTCTGAGGGTCGCT728140.5508468133095011No Hit
AACTCCAGTCACGTTTCGATCT722920.5468978194821115TruSeq Adapter, Index 21 (95% over 22bp)
TTAGGTAGTAGGTTGTATAGTT702140.5311774953952992No Hit
TAACGGAACCCATAATGCAGCTG679860.514322402967283No Hit
TTCAAGTAATCCAGGATAGGTT661200.5002058848027058No Hit
CTACGCCTGTCTGAGGGTCGCT655310.49575002778291155No Hit
TTCACAGTGGCTAAGTTCTGC625900.4735010031730392No Hit
TGATGTAGTAGGTTGTATAGTT617120.4668588258158587No Hit
CTGTCTGAGGGTCGCT606850.45908944523974893No Hit
ACCCTGTAGAACCGAATTTGCG584670.44231000403447973No Hit
TCCTTCATTCCACCGGAGTCT570930.4319155260290515No Hit
TTCACAGTGGCTAAGTTCAGT552540.41800326616589084No Hit
CCACGTTCCCGTGG547780.414402267963137No Hit
AAGCTGCCAGCTGAAGAACT533310.40345553603165607No Hit
TTGTTCCCCTTCAACCAGCTGT504950.38200084926062655No Hit
TACCCTGTAGATCCGGATTTGT476860.3607504207910137No Hit
AACTCCAGTCACGTTTCGATCTCG460830.34862352978468075TruSeq Adapter, Index 21 (95% over 24bp)
TAGCTTATCAGACTGGTGTTGG460700.3485251831951097No Hit
AACTCCAGTCACGTTTCGATCTCGTATGC453630.34317664174690177TruSeq Adapter, Index 21 (96% over 29bp)
TTCAAGTAATCCAGGATAGGC421830.31911955291337774No Hit
ACATTAGTCTGCACATTGGTT419800.3175838330916151No Hit
TTATGTAGTAGGTTGTATAGTT403430.3051997279279425No Hit
TGAGGTAGTAGTTTGTATAGTT374960.28366182481189134No Hit
AACTCCAGTCACGTTTCGATCTC373670.28268592403845594TruSeq Adapter, Index 21 (95% over 23bp)
AAGCTGCCAGCTGAAGAACTGC360470.27269996263586105No Hit
TACAGTAGTCTGCACATTGGTT348840.26390172543039303No Hit
TTCAGTCATTGTTTCTGGTTGT343520.25987708038025636No Hit
TGTCTGAGGGTCGCT343410.25979386403523475No Hit
TTCCATTTGTCATCCTATGCCT330610.2501105075236276No Hit
TTCACAGTGGTTAAGTTCTGCC328510.24852183184594204No Hit
TTCCCTTTGTCATCCTATGCCTG305490.23110692036959862No Hit
TACCATGTAGAACCGAATTTGT296390.22422265909962788No Hit
TTCAAGTAATCCAGGATAGGCTT284980.2155908545842031No Hit
CATTGCACTTGTCTCGGTCTGA282640.21382061597192492No Hit
TTCACAGTGGTTAAGTTCTGC276650.2092891077293838No Hit
TTTTGTCCCCTTCAACCAGCTGT270270.20446255971812963No Hit
TGAGGTAGTAGGTTGTATAGT269100.20357744041199052No Hit
ATGACCTATGAATTGACAGCC268690.2032672703987281No Hit
ACAGTAGTCTGCACATTGGTTA265520.20086912663765036No Hit
TACCCTGTAGAACCGAATTTG248950.18833371902848398No Hit
TCCAGCATCAGTGATTTTGTTG246690.18662400139440333No Hit
TCCAGCATCAGTGATTTTGTT245670.18585235892238466No Hit
TTTGGTCCCCTTCAACCAGCTG245370.18562540525414387No Hit
TATTGCACTTGTCCCGGCCTGTT241280.1825312702437944No Hit
TATGTGCCCTTGGACTACATCG240170.18169154167130347No Hit
CACCACGTTCCCGTGG233250.17645647705721584No Hit
AACATTCATTGCTGTCGGTGGG229930.17394485646201774No Hit
TTCAAGTAATCCAGGATGGGCT229250.1734304281473386No Hit
TGAGGTAGTAGGTTGTATAGTTT221790.1677868469304176No Hit
ACCCTGTAGAACCGAATTTGTG219720.16622086661955612No Hit
ATGACCTATGAATTGACAGCCA210460.15921556339319035No Hit
CATTATTACTTTTGGTACGCG209520.15850444189936921No Hit
AACATTAAGAGTTTATGTGCTG203810.15418475708051946No Hit
AACATTCATTGCTGTCGGTGGGT192430.14557564793191874No Hit
AACCCGTAGATCCGAACTTGTG183190.13858547495010234No Hit
TACAGTACTGTGATAACTGAAG182500.1380634815131485No Hit
TTCCAGTGATGACAGCCTATAATCTGACT178680.13517360480421578No Hit
TTTCTGAGGGTCGCT167600.12679144932385586No Hit
TTCAGGTAATCCAGGATAGGCT166750.12614841393050694No Hit
TGAGGTAGTAGATTGAATAGTT165150.12493799436655605No Hit
TCCCTGAGACCCTTAACCTGTG162080.12261550182822527No Hit
ACCACGTTCCCGTGG156790.11861355214491263No Hit
AACATTCAACGCTGTCGGTGAGA155370.11753930478190623No Hit
TACCATGTAGAACCGAATTTGC152370.11526976809949831No Hit
TTCACAGTGGTTAAGTTCTGCCT151780.1148234258852914No Hit
TGAGATGAAGCACTGTAGCTC149050.1127581475043002No Hit
TGTAAACATCCTTGACTGGAAGCT148630.11244041236876309No Hit
AACATTCAACGCTGTCGGTGG148610.11242528212421371No Hit
CATAAAGTAGAAAGCACTACT147840.11184276770906233No Hit
TTCACAGTGGCTAAGTTCTGCT145500.11007252909678417No Hit
TGGACGGAGAACTGATAAGGGC143570.1086124604977684No Hit
ACCCTGTAGAACCGAATTTGC141630.10714482677647795No Hit
TAGCAGCACGTAAATATTGGAG141080.10672874505136982No Hit
GAAGGATCATTA138250.10458781544763168No Hit
TGAGATGAAGCACTGTAGCTCT136400.10318826782681347No Hit
TACCCTGTAGAACCGAATGTGT136020.10290079318037514No Hit
TACCCTGTAGATCCGGATTTGTG135930.10283270707990291No Hit
ACCCTGTAGAACCGAATTTGT135310.10236366949887192No Hit
AACTCCAGTCACGTTTCGATCTCGTAT135080.10218967168655398TruSeq Adapter, Index 21 (96% over 27bp)
TATTGCACTTGTCCCGGCCTGTAT134660.10187193655101688No Hit
AACACTCAACGCTGTCGGTGAG133730.10116838017947041No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTACGT50.0041140881410.525623
GGTAGGG50.0041140881410.525623
CGTATGC48400.01375.553823
GATTCCT12400.01097.707523
AATAACC1900.0853.739223
TCGTATG50500.0788.564222
ATAACTA5750.0776.576622
ACAACCC2900.0727.888422
GCATAGC1250.0681.9754622
GGATTCC20200.0663.1656522
TAACTGC2150.0656.058423
CGTTCTA101.08231514E-4586.006721
TCTGACT53100.0585.7267523
CGGGGTG251.21180965E-4564.2102723
CTCGTAT68650.0543.32621
TAACTAA702.1827873E-11503.759223
GACAACC5300.0497.5528621
TAATAAC2650.0490.18922
GTATGCC1300.0488.2588223
TCTCGTA74950.0458.3144520