FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_14_JG67_5_CGTACG_L002_R1_001_TRIMMED_prinseq_good_Q5y5.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_14_JG67_5_CGTACG_L002_R1_001_TRIMMED_prinseq_good_Q5y5.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10546826
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG6584306.24292085599971No Hit
TTCAAGTAATCCAGGATAGGCT5351195.073744461129823No Hit
AACATTCAACGCTGTCGGTGAGT5237094.96556025481031No Hit
TTCCCTTTGTCATCCTATGCCT3853123.653345565765473No Hit
TACCCTGTAGAACCGAATTTGT3260213.091176435450817No Hit
AAGCTGCCAGCTGAAGAACTGT2112152.002640415230137No Hit
TAGCTTATCAGACTGGTGTTGGC2011351.9070666378681131No Hit
TCCTTCATTCCACCGGAGTCTG1811281.717369756550454No Hit
TGAGGTAGTAGGTTGTATAGTT1745541.655038207703436No Hit
AACAGTAAGAGTTTATGTGCTG1686331.5988980950287792No Hit
TACCCTGTAGAACCGAATTTGC1581681.4996739303369564No Hit
TATTGCACTTGTCCCGGCCTGT1340481.2709795345064003No Hit
TACCCTGTAGAACCGAATTTGCG1333621.2644752079914847No Hit
AACATTCAACGCTGTCGGTGA1229281.1655449705911523No Hit
CCTGTCTGAGGGTCGCT1116031.0581666939418553No Hit
TTCACAGTGGTTAAGTTCTG751680.7127073111853746No Hit
TTCACAGTGGCTAAGTTCTG736040.6978782052534099No Hit
TTCACGTAATCCAGGATAGGCT730530.6926538846853072No Hit
TCCTTCATTCCACCGGAGTCTGT691030.6552018588341175No Hit
TTGGTCCCCTTCAACCAGCTGT644720.611292914095672No Hit
ACCCTGTAGAACCGAATTTGCG604700.573347848916821No Hit
ACAGTAGTCTGCACATTGGTT587100.5566603639805947No Hit
TAACGGAACCCATAATGCAGCTG489560.464177563941986No Hit
AAGCTGCCAGCTGAAGAACT489060.46370348766538866No Hit
CCTTTCTGAGGGTCGCT465430.4412986428333984No Hit
TTTGGTCCCCTTCAACCAGCTGT456000.43235756425677263No Hit
TTCACAGTGGCTAAGTTCTGC435100.4125411758950039No Hit
TTAGGTAGTAGGTTGTATAGTT428990.40674796379498435No Hit
TTCCCTTTGTCATCCTATGCCTG401010.3802186553565973No Hit
TTCACAGTGGCTAAGTTCAGT382950.36309502024590146No Hit
TTCAAGTAATCCAGGATAGGC376730.3571975113650306No Hit
CTACGCCTGTCTGAGGGTCGCT366650.34764013362882823No Hit
TTATGTAGTAGGTTGTATAGTT363450.3446060454586053No Hit
TTCAAGTAATCCAGGATAGGTT359020.34040572964795285No Hit
AAGCTGCCAGCTGAAGAACTGC356600.3381112004692217No Hit
TGATGTAGTAGGTTGTATAGTT349740.3316068739543062No Hit
ATGACCTATGAATTGACAGCC341510.3238035784415141No Hit
TCCTTCATTCCACCGGAGTCT334930.3175647346414931No Hit
TAGCTTATCAGACTGGTGTTGG326250.30933477047976327No Hit
AACATTCATTGCTGTCGGTGGG325100.3082443950435894No Hit
TTCCATTTGTCATCCTATGCCT320640.3040156346563412No Hit
TATTGCACTTGTCCCGGCCTGTT289970.27493579584986044No Hit
AACATTCATTGCTGTCGGTGGGT285740.27092511054984697No Hit
TACCATGTAGAACCGAATTTGT281490.2668954621987696No Hit
CTGTCTGAGGGTCGCT280110.2655870116753609No Hit
CATTGCACTTGTCTCGGTCTGA279890.2653784181136581No Hit
ATGACCTATGAATTGACAGCCA263610.24994249454764875No Hit
TGAGGTAGTAGGTTGTATAGT263320.2496675303072223No Hit
TGAGGTAGTAGTTTGTATAGTT259950.2464722562029562No Hit
CCACGTTCCCGTGG254450.2412574171603855No Hit
TACCCTGTAGATCCGGATTTGT254130.2409540083433632No Hit
ACCCTGTAGAACCGAATTTGTG252200.2391240739156975No Hit
TACAGTAGTCTGCACATTGGTT252060.23899133255825022No Hit
TACCCTGTAGAACCGAATTTG244060.23140611213269283No Hit
TATGTGCCCTTGGACTACATCG240250.22779365090502107No Hit
TTGTTCCCCTTCAACCAGCTGT238300.22594475342629147No Hit
TTCAGTCATTGTTTCTGGTTGT227890.2160744853475349No Hit
ACATTAGTCTGCACATTGGTT219760.20836600509006215No Hit
AACTCCAGTCACCGTACGATCT219190.20782555813474118TruSeq Adapter, Index 22 (95% over 22bp)
ACAGTAGTCTGCACATTGGTTA215310.20414672622834584No Hit
TTCAAGTAATCCAGGATAGGCTT214070.20297101706238446No Hit
TTCACAGTGGTTAAGTTCTGCC212730.20170049264110357No Hit
AACATTCAACGCTGTCGGTGG211780.20079974771556866No Hit
AACTCCAGTCACCGTACGATCTCGTATGC210580.19966196465173502TruSeq Adapter, Index 22 (96% over 29bp)
CACCACGTTCCCGTGG194200.18413122583040623No Hit
TCCAGCATCAGTGATTTTGTT190210.18034809714315947No Hit
TGAGGTAGTAGGTTGTATAGTTT187330.1776174177899588No Hit
AACCCGTAGATCCGAACTTGTG183260.17375843689845646No Hit
TTCCAGTGATGACAGCCTATAATCTGACT174440.16539573137927943No Hit
TGAGATGAAGCACTGTAGCTC166450.15781999247925393No Hit
TTCACAGTGGTTAAGTTCTGC165790.15719421179414544No Hit
TTTTGTCCCCTTCAACCAGCTGT165200.1566348017877606No Hit
AACATTCAACGCTGTCGGTGAGA163460.15498501634520187No Hit
TATTGCACTTGTCCCGGCCTGTA161630.15324989717285561No Hit
CATTATTACTTTTGGTACGCG157890.14970380662390753No Hit
TATTGCACTTGTCCCGGCCTGTAT155920.147835946094114No Hit
AACACTCAACGCTGTCGGTGAG154870.1468403859132596No Hit
TTTGGTCCCCTTCAACCAGCTG151230.14338911061963097No Hit
TGTCTGAGGGTCGCT151220.14337962909409901No Hit
TACCCTGTAGAACCGAATGTGT150750.1429339973940975No Hit
TCCAGCATCAGTGATTTTGTTG150350.14255473637281965No Hit
ACCCTGTAGAACCGAATTTGC148280.14059206058770668No Hit
TCCCTGAGACCCTTAACCTGTG145980.13841130971535892No Hit
TGAGATGAAGCACTGTAGCTCT145340.13780449208131432No Hit
TGTAAACATCCTTGACTGGAAGCT140030.1327698020238506No Hit
ACCCTGTAGAACCGAATTTGT140010.1327508389727867No Hit
TGTAAACATCCTACACTCTCAGCT137910.13075971861107788No Hit
TTCACAGTGGCTAAGTTCTGCT137810.1306649033557584No Hit
TATTGCACTTGTCCCGGCCTGTTT137220.13010549334937355No Hit
TACCATGTAGAACCGAATTTGC134280.1273179248429812No Hit
TCCAGTGATGACAGCCTATAATCTGACT131890.12505184024084592No Hit
CCCAGTGTTCAGACTACCTGTTC130500.12373390819190531No Hit
TGAGGTAGTAGATTGAATAGTT128220.12157212037062146No Hit
TACCCTGTAGAACCGAATTTGTG126860.1202826328982767No Hit
TCCCTGAGACCCTTAACCTGTGA124310.11786484388763027No Hit
AACACTCAACGCTGTCGGTGAGT121990.11566512996421861No Hit
TACCATGTAGAACCGAATTTGCG119210.11302926586633742No Hit
CCCAGTGTTCAGACTACCTGTT118820.1126594863705915No Hit
TTCACAGTGGTTAAGTTCTGCCT117360.11127518364292725No Hit
TACAGTACTGTGATAACTGAAG111850.10605086307482459No Hit
TCCCTGAGACCCTAACTTGTGA109590.10390803830460463No Hit
ACCACGTTCCCGTGG108110.1025047725258765No Hit
ACCCTGTAGAACCGAATTTGTGT106300.10078861640459415No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC24300.01101.30223
GATTCCT10900.0868.4317623
AATAACC1350.0822.369523
TAACTGC3150.0779.08723
TAACTAA750.0779.086923
CAACCCG5400.0735.804323
ATAACTA8050.0610.405822
TCGTATG25150.0583.646322
ACAACCC7500.0563.361822
TCTGACT44000.0559.083423
GGATTCC17300.0483.0366522
AAATAGC2650.0463.0422423
GCATAGC750.0459.0355522
GTACTCT3350.0453.4983523
TAATAAC1800.0452.0804422
GACAACC12100.0412.3819321
CTCGTAT31650.0383.192321
GAAAATA1300.0373.1703821
CGATAAA4050.0366.624620
GCTGAGC2450.0357.7440223