FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_14_JG68_5_GAGTGG_L003_R1_001_TRIMMED_prinseq_good_ghgC.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_14_JG68_5_GAGTGG_L003_R1_001_TRIMMED_prinseq_good_ghgC.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences27861305
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT5808722.0848700374946545No Hit
TTCCCTTTGTCATCCTATGCCT4067951.460071593918519No Hit
AACATTCAACGCTGTCGGTGAG4025031.4446667160780875No Hit
AACATTCAACGCTGTCGGTGAGT3629681.3027674044701065No Hit
TACCCTGTAGAACCGAATTTGT3602391.2929724576792079No Hit
TGAGGTAGTAGGTTGTATAGTT3388541.2162172590264526No Hit
TAGCTTATCAGACTGGTGTTGGC2849191.0226333619333337No Hit
CCTGTCTGAGGGTCGCT2624040.9418223590029254No Hit
AAGCTGCCAGCTGAAGAACTGT2390960.8581651146635091No Hit
AACAGTAAGAGTTTATGTGCTG2113240.7584856488237002No Hit
ATGACCTATGAATTGACAGCC2057590.7385117100580896No Hit
TCCTTCATTCCACCGGAGTCTG1885580.6767737548546272No Hit
TACCCTGTAGAACCGAATTTGC1620590.5816633499399975No Hit
TATTGCACTTGTCCCGGCCTGT1614170.5793590788371183No Hit
ATGACCTATGAATTGACAGCCA1565980.5620626887362239No Hit
TGAGATGAAGCACTGTAGCTCT1540270.5528348367027316No Hit
TACCCTGTAGAACCGAATTTGCG1511940.5426666123499958No Hit
TTGGTCCCCTTCAACCAGCTGT1432530.5141647169793375No Hit
TGAGATGAAGCACTGTAGCTC1297600.4657355425382982No Hit
ACAGTAGTCTGCACATTGGTT1054010.3783060412999319No Hit
TTTGGTCCCCTTCAACCAGCTGT943660.3386991384646197No Hit
AACATTCAACGCTGTCGGTGA932800.3348012593092822No Hit
TTCACAGTGGTTAAGTTCTG920190.33027526887200725No Hit
TTCACAGTGGCTAAGTTCTG873550.31353520590654316No Hit
CCACGTTCCCGTGG859890.30863234870010575No Hit
CTACGCCTGTCTGAGGGTCGCT815670.292760873907378No Hit
TCCTTCATTCCACCGGAGTCTGT792800.284552356754287No Hit
TTCACAGTGGCTAAGTTCTGC761540.27333249465522164No Hit
TGAGATGAAGCACTGTAGCT705400.2531826847306686No Hit
CTGTCTGAGGGTCGCT668880.24007489957846556No Hit
ACCCTGTAGAACCGAATTTGCG662600.2378208773781415No Hit
AACTCCAGTCACGAGTGGATCT634830.22785364863562563RNA PCR Primer, Index 23 (100% over 22bp)
TGTCTGAGGGTCGCT631120.22652205271791828No Hit
TGAGGTAGTAGTTTGTATAGTT605060.21716857842803847No Hit
TAACGGAACCCATAATGCAGCTG557200.1999906321688808No Hit
TTCAAGTAATCCAGGATAGGTT522330.18747506622536167No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT494240.1773929828484344No Hit
TGTAAACATCCTTGACTGGAAGCT459950.16508559092978595No Hit
TGAGGTAGTAGGTTGTATAGT449360.16128462037223312No Hit
AAGCTGCCAGCTGAAGAACT419620.15061031778662198No Hit
TTCACAGTGGCTAAGTTCAGT419350.15051340918883735No Hit
TTCCCTTTGTCATCCTATGCCTG418750.15029805674931593No Hit
AACTCCAGTCACGAGTGGATCTCG411230.14759897284064763RNA PCR Primer, Index 23 (100% over 24bp)
TAGCTTATCAGACTGGTGTTGG410800.1474446369256573No Hit
GTGTAATGGTTAGCACTCTG409710.1470534133271934No Hit
TTCAAGTAATCCAGGATAGGC384890.13814500074565783No Hit
ACAGTAGTCTGCACATTGGTTA366770.1316413570721113No Hit
AAGCTGCCAGCTGAAGAACTGC351590.12619294035221967No Hit
AACTCCAGTCACGAGTGGATCTC350050.12564020242411472RNA PCR Primer, Index 23 (100% over 23bp)
CACCACGTTCCCGTGG336790.12088091351069162No Hit
TGAGGTAGTAGGTTGTATAGTTT328110.11776548155228192No Hit
TACCCTGTAGATCCGGATTTGT324790.11657386472026345No Hit
TGTAAACATCCTACACTCTCAGCT324200.1163621014880674No Hit
CATTGCACTTGTCTCGGTCTGA319020.11450289209353258No Hit
TTCACAGTGGTTAAGTTCTGCC318360.11426600441005903No Hit
TCCAGCATCAGTGATTTTGTT306590.1100415073881141No Hit
TTTGGTCCCCTTCAACCAGCTG304280.10921240049595667No Hit
TACAGTAGTCTGCACATTGGTT290030.10409778005732323No Hit
TCCAGCATCAGTGATTTTGTTG289060.10374962694676362No Hit
TATTGCACTTGTCCCGGCCTGTT284600.10214884047965449No Hit
CACGTTCCCGTGG282630.1014417666365592No Hit
TCCTTCATTCCACCGGAGTCT282110.10125512785564064No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC281130.10090338553775569No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC32450.0180.26823
GATTCCT84550.0145.5023723
ATTCGGC46800.089.6923
ACACGCC27200.076.7493723
TTCTCGC41000.072.9714623
TCGTATG36500.068.9902622
GGATTCC97500.065.33288622
ATATGCC19350.058.17622
CAACCCG17200.057.76484723
ATTCTCG60350.057.34380323
TTACGCC4500.054.57732423
ACGAAGT9350.053.7282923
TACCCGC13300.048.94815422
CATAGCT16550.043.84473423
AATTCTC105900.041.6657622
CCGCCCA8150.039.7230423
CTCGTAT56850.039.06248521
TCTGACT130950.038.70369723
TCTCGTA54600.037.53380220
ACAACCC34150.036.53791822