FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_14_JG69_5_GGTAGC_L004_R1_001_TRIMMED_prinseq_good_F4uD.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_14_JG69_5_GGTAGC_L004_R1_001_TRIMMED_prinseq_good_F4uD.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences46275011
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC43629749.428358644798593No Hit
ATGACCTATGAATTGACAGCCA33404397.218667111716083No Hit
TTCAAGTAATCCAGGATAGGCT7012451.5153859174663407No Hit
AACATTCAACGCTGTCGGTGAG4688791.0132444917192995No Hit
TAGCTTATCAGACTGGTGTTGGC4640041.002709648194357No Hit
TTCCCTTTGTCATCCTATGCCT3832480.8281964535891737No Hit
TACCCTGTAGAACCGAATTTGT3751770.8107550746989558No Hit
AACATTCAACGCTGTCGGTGAGT3691820.7977999184052058No Hit
TGAGGTAGTAGGTTGTATAGTT3318840.7171991812168343No Hit
TGAGATGAAGCACTGTAGCTCT2783700.6015557727258023No Hit
CCTGTCTGAGGGTCGCT2664960.5758961353893574No Hit
AAGCTGCCAGCTGAAGAACTGT2593850.5605293103009743No Hit
TACCCTGTAGAACCGAATTTGC2413800.5216206215488528No Hit
TCCTTCATTCCACCGGAGTCTG2403140.5193170024313987No Hit
TACCCTGTAGAACCGAATTTGCG2363320.5107119261408711No Hit
TGAGATGAAGCACTGTAGCTC2237240.48346611954344No Hit
TTCACAGTGGTTAAGTTCTG2128290.4599220948861579No Hit
AACAGTAAGAGTTTATGTGCTG2042100.44129649153405925No Hit
TGGGAATACCAGGTGCTGTAAGCTT1815260.3922765139915364No Hit
ATGACCTATGAATTGACAGCCT1665450.3599026697151947No Hit
ATGACCTATGAATTGACAGC1587050.3429604803335433No Hit
TGTAACAGCAACTCCATGTGGA1496810.3234596745962956No Hit
TATTGCACTTGTCCCGGCCTGT1367980.2956195947743805No Hit
AACTCCAGTCACGGTAGCATCT1282690.2771884808412039RNA PCR Primer, Index 24 (100% over 22bp)
TGAGATGAAGCACTGTAGCT1270850.2746298644856076No Hit
ATGACCTATGAATTGACAGCCAT1248900.26988648365745393No Hit
ATTACCTATGAATTGACAGCC1079600.23330086296467872No Hit
TTGGTCCCCTTCAACCAGCTGT1061020.2292857369607108No Hit
TTCACAGTGGCTAAGTTCTG994310.21486974903150213No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT987420.21338082447997692No Hit
ACAGTAGTCTGCACATTGGTT957130.2068351750364792No Hit
ACCCTGTAGAACCGAATTTGCG947810.20482112905386451No Hit
TCCTTCATTCCACCGGAGTCTGT903400.1952241567268347No Hit
TAACGGAACCCATAATGCAGCTG886510.1915742386317315No Hit
CTACGCCTGTCTGAGGGTCGCT866320.18721119266724756No Hit
GTGTAATGGTTAGCACTCTG794800.17175576684357785No Hit
CTGTCTGAGGGTCGCT781880.1689637631852751No Hit
AACATTCAACGCTGTCGGTGA780710.16871092694067646No Hit
ATGAACTATGAATTGACAGCC761530.1645661413240939No Hit
AACTCCAGTCACGGTAGCATCTC739890.15988975129579117RNA PCR Primer, Index 24 (100% over 23bp)
TAGCTTATCAGACTGGTGTTGG730730.15791028120987372No Hit
TTCAAGTAATCCAGGATAGGTT724890.1566482609804242No Hit
GGAATACCAGGTGCTGTAAGCTT711250.15370066578698383No Hit
TACCCTGTAGATCCGGATTTGT677290.146361931712993No Hit
TACGACCTCAGATCAGACGAGACAACCCG673820.14561206695337145No Hit
TTCACAGTGGCTAAGTTCTGC671320.14507181856747695No Hit
TTAGATGAAGCACTGTAGCTCT669530.14468500072317647No Hit
TGAGGTAGTAGTTTGTATAGTT654860.1415148231947476No Hit
TACGACCTCAGATCAGACGAGACAACC592340.12800429156029808No Hit
TACGACCTCAGATCAGAC563730.12182168903212146No Hit
TCAGTAACTGGAATCTGTCCCT561100.12125334773016044No Hit
TTTGGTCCCCTTCAACCAGCTGT560870.12120364487865816No Hit
AAGCTGCCAGCTGAAGAACT558000.12058343973165128No Hit
AACTCCAGTCACGGTAGCATCTCG516260.11156345268075679RNA PCR Primer, Index 24 (100% over 24bp)
CAGTCGGTAGAGCATC510640.11034897430926598No Hit
TACCCTGTAGAACCGAATGTGT483100.10439759809025222No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGC479380.1035937084920412No Hit
TGTCTGAGGGTCGCT479210.10355697160180038No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC34400.0270.0919223
CAACCCG100200.0265.96923
GATTCCT157250.0237.392523
ATTCGGC94150.0201.2324423
TTCTCGC76500.0172.6708723
ACAACCC143500.0111.9171622
GGATTCC188650.0102.1654122
TCGTATG41200.099.7803422
TAACTGC32050.091.8175523
ATATGCC21900.082.90729522
GATTCGG109050.080.1707622
TACCCGC15900.079.7196922
TATCTCC20450.076.8004923
ATTCTCG109750.073.6610723
ACGAAGT9450.073.4769623
ATTCCTG61100.072.5149123
TCACGTT27400.068.5158422
CATAGCT18650.068.25674423
TCTGACT143200.066.96049523
GACAACC230900.066.88747421