FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_14_JG70_5_ACTGAT_L005_R1_001_TRIMMED_prinseq_good_HduV.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_14_JG70_5_ACTGAT_L005_R1_001_TRIMMED_prinseq_good_HduV.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24716109
Sequences flagged as poor quality0
Sequence length12-29
%GC45

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCC22638889.159564719511474No Hit
ATGACCTATGAATTGACAGCCA18097397.322103167614287No Hit
TTCAAGTAATCCAGGATAGGCT10985754.4447732448501505No Hit
TGAGGTAGTAGGTTGTATAGTT7712403.120394071736777No Hit
AACATTCAACGCTGTCGGTGAG6904412.79348581930918No Hit
AACATTCAACGCTGTCGGTGAGT6188292.503747657044238No Hit
TTCCCTTTGTCATCCTATGCCT5942122.4041486465365565No Hit
TAGCTTATCAGACTGGTGTTGGC5418282.192205901017834No Hit
TACCCTGTAGAACCGAATTTGT5325752.154768778532252No Hit
AAGCTGCCAGCTGAAGAACTGT4620771.8695377982027832No Hit
TCCTTCATTCCACCGGAGTCTG4512901.8258941971812797No Hit
CCTGTCTGAGGGTCGCT4079881.6506967176751No Hit
AACAGTAAGAGTTTATGTGCTG3877581.5688472647535256No Hit
TACCCTGTAGAACCGAATTTGC3070071.2421332176516944No Hit
TACCCTGTAGAACCGAATTTGCG2645911.0705204447836025No Hit
TTGGTCCCCTTCAACCAGCTGT2440110.9872549113616548No Hit
TATTGCACTTGTCCCGGCCTGT2282210.9233694510733871No Hit
TCCTTCATTCCACCGGAGTCTGT2095490.8478235793506171No Hit
TTCACAGTGGTTAAGTTCTG2093820.8471479066547247No Hit
ACAGTAGTCTGCACATTGGTT1936020.7833029058093246No Hit
TGAGATGAAGCACTGTAGCTCT1907730.7718569294220219No Hit
AACATTCAACGCTGTCGGTGA1660620.6718776001513831No Hit
TGAGATGAAGCACTGTAGCTC1654230.6692922417521302No Hit
TTTGGTCCCCTTCAACCAGCTGT1598430.6467158726318936No Hit
TGTAACAGCAACTCCATGTGGA1437710.5816894560547536No Hit
TTCACAGTGGCTAAGTTCTG1425350.5766886689162926No Hit
TAACGGAACCCATAATGCAGCTG1266900.5125806816922518No Hit
TGAGGTAGTAGTTTGTATAGTT1207450.48852754290734035No Hit
CTACGCCTGTCTGAGGGTCGCT1187790.4805732164395293No Hit
TGAGGTAGTAGGTTGTATAGT1090690.4412870974148884No Hit
TTCACAGTGGCTAAGTTCTGC1051720.4255200525293039No Hit
ACCCTGTAGAACCGAATTTGCG1051610.4254755471421493No Hit
CTGTCTGAGGGTCGCT1046220.4232947831715745No Hit
ATGACCTATGAATTGACAGC1008840.40817104342758803No Hit
AAGCTGCCAGCTGAAGAACT939150.3799748576930131No Hit
TTCAAGTAATCCAGGATAGGTT925700.374533062627293No Hit
AACTCCAGTCACACTGATATCT907220.3670561575853222TruSeq Adapter, Index 25 (100% over 22bp)
TGAGGTAGTAGGTTGTATAGTTT905010.3661620038979436No Hit
ATGACCTATGAATTGACAGCCT880330.35617661339816875No Hit
TAGCTTATCAGACTGGTGTTGG841960.3406523251697911No Hit
TGAGATGAAGCACTGTAGCT823170.3330499958549301No Hit
TGTCTGAGGGTCGCT795300.32177394912767215No Hit
TTCACAGTGGCTAAGTTCAGT783560.3170240105349916No Hit
ATGACCTATGAATTGACAGCCAT776670.3142363549213996No Hit
TTCCCTTTGTCATCCTATGCCTG747720.3025233462111694No Hit
AAGCTGCCAGCTGAAGAACTGC731090.29579494086225305No Hit
TCCTTCATTCCACCGGAGTCT709040.2868736337099015No Hit
TTCAAGTAATCCAGGATAGGC697860.28235026799728064No Hit
TGAGGTAGTAGATTGAATAGTT665100.2690957545137869No Hit
TACCCTGTAGATCCGGATTTGT631040.25531526827301176No Hit
TTCACAGTGGTTAAGTTCTGCC608840.24633327195635848No Hit
CCACGTTCCCGTGG597620.2417937224665905No Hit
CCTTTCTGAGGGTCGCT595490.2409319363335062No Hit
ACAGTAGTCTGCACATTGGTTA590540.23892919391154976No Hit
TGTAAACATCCTTGACTGGAAGCT569870.23056622707077395No Hit
TTCACAGTGGTTAAGTTCTGC567970.2297974976562856No Hit
TACAGTAGTCTGCACATTGGTT510660.20661019094874522No Hit
TTCAGTCATTGTTTCTGGTTGT509930.2063148370158102No Hit
TTCAAGTAATCCAGGATAGGCTT506060.20474905657682607No Hit
CATTGCACTTGTCTCGGTCTGA496880.20103487972156134No Hit
AACTCCAGTCACACTGATATCTC461970.1869104882164098TruSeq Adapter, Index 25 (100% over 23bp)
TATTGCACTTGTCCCGGCCTGTT459830.1860446561390387No Hit
TACCCTGTAGAACCGAATTTG458530.18551868338175723No Hit
CACCACGTTCCCGTGG448890.18161839308930058No Hit
TATGTGCCCTTGGACTACATCG444060.1796642019987855No Hit
AACTCCAGTCACACTGATATCTCG434480.17578818737204954TruSeq Adapter, Index 25 (100% over 24bp)
TGATGTAGTAGGTTGTATAGTT424360.17169369175382743No Hit
TCCAGCATCAGTGATTTTGTT420730.17022501397772602No Hit
TGTAAACATCCTACACTCTCAGCT417830.1690516901345596No Hit
TTTGGTCCCCTTCAACCAGCTG394540.15962868589064727No Hit
TCCAGCATCAGTGATTTTGTTG385340.155906417146809No Hit
AACCCGTAGATCCGAACTTGTG378620.15318754258609235No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT369640.14955428461656323No Hit
CATTATTACTTTTGGTACGCG358150.14490549463105218No Hit
TTCCAGTGATGACAGCCTATAATCTGACT346960.1403780829741445No Hit
ACCCTGTAGAACCGAATTTGTG341760.13827419194501853No Hit
TTGTTCCCCTTCAACCAGCTGT336460.13612984147302476No Hit
TACCCTGTAGAACCGAATGTGT331330.13405427205390621No Hit
TGGACGGAGAACTGATAAGGGC322510.1304857491929656No Hit
AACATTCATTGCTGTCGGTGGG316680.12812696367377244No Hit
AACATTCATTGCTGTCGGTGGGT313490.12683630744628938No Hit
TGAGGTAGTTGGTTGTATAGTT305490.12359955201686479No Hit
CATAAAGTAGAAAGCACTACT298170.12063792079894128No Hit
TTAGGTAGTAGGTTGTATAGTT292690.11842074332978544No Hit
TTCACAGTGGTTAAGTTCTGCCT285010.11531345811753783No Hit
TACAGTACTGTGATAACTGAAG275320.11139293810364731No Hit
ACATTAGTCTGCACATTGGTT268880.10878734998296051No Hit
TGTAAACATCCCCGACTGGAAGCT265850.10756142886406594No Hit
TACCCTGTAGATCCGGATTTGTG259570.10502057585196764No Hit
TATTGCACTTGTCCCGGCCTGTTT258240.10448246526182581No Hit
AACTCCAGTCACACTGATATCTCGTATGC257930.1043570409889356TruSeq Adapter, Index 25 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCT257680.10425589238176607No Hit
CACGTTCCCGTGG254920.1031392117586146No Hit
TAATACTGTCTGGTAATGCCG254810.10309470637146001No Hit
TATTGCACTTGTCCCGGCCTGTAT254660.1030340172071583No Hit
TCCCTGAGACCCTTAACCTGTG254310.10289240915712097No Hit
TGAGGTAGTAGGTTGTGTGGTT249290.10086134512515704No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC26200.01492.615523
CAACCCG3950.01293.03323
GATTCCT46500.01198.384923
GCTTCCT3200.01191.110123
TAACTAA1150.01126.893723
TAACTGC2850.01123.404923
ATAACTA11500.0828.047522
AATAACC2400.0825.836323
TCGTATG27800.0825.4848622
ACAACCC11350.0763.4060722
TCTGACT80850.0724.1242723
GGATTCC58500.0718.572122
GCGGAAT203.212317E-7643.415322
CATAGCT3150.0629.208723
ATCACTA750.0629.117222
CGATGTA151.16428106E-4571.9247422
ATTCGGC25350.0553.314123
AGTATTT701.2732926E-11544.5074523
GTATGCC701.2732926E-11544.5074523
GCATAGC3800.0541.823422