FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_5_JG18_5_TGACCA_L004_R1_001_TRIMMED_prinseq_good_J3Fs.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_5_JG18_5_TGACCA_L004_R1_001_TRIMMED_prinseq_good_J3Fs.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences12160710
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TAGCTTATCAGACTGGTGTTGGC7762316.3831059206247005No Hit
AACATTCAACGCTGTCGGTGAG6667025.482426601736248No Hit
AACATTCAACGCTGTCGGTGAGT4747343.9038345622911823No Hit
TTCAAGTAATCCAGGATAGGCT4254833.498833538502275No Hit
TACCCTGTAGAACCGAATTTGT3489392.869396605954751No Hit
TTCCCTTTGTCATCCTATGCCT3355182.759032984093856No Hit
TCCTTCATTCCACCGGAGTCTG3206402.6366881538989086No Hit
AAGCTGCCAGCTGAAGAACTGT2603782.1411414300645277No Hit
CCTGTCTGAGGGTCGCT2256131.855261740474035No Hit
TGAGGTAGTAGGTTGTATAGTT1844701.516934455307297No Hit
TACCCTGTAGAACCGAATTTGCG1561921.2843986905369835No Hit
TTGGTCCCCTTCAACCAGCTGT1485691.2217132058901166No Hit
AACAGTAAGAGTTTATGTGCTG1363121.1209213935699478No Hit
TATTGCACTTGTCCCGGCCTGT1277611.0506047755435333No Hit
TACCCTGTAGAACCGAATTTGC1184590.9741125312584544No Hit
AACATTCAACGCTGTCGGTGA967490.7955867708382158No Hit
TCCTTCATTCCACCGGAGTCTGT794680.6534815812563576No Hit
TTTGGTCCCCTTCAACCAGCTGT750610.6172419209075786No Hit
ACAGTAGTCTGCACATTGGTT735660.6049482308187598No Hit
TAGCTTATCAGACTGGTGTTGG682780.5614639276818542No Hit
TTCACAGTGGTTAAGTTCTG638840.5253311689860214No Hit
AACTCCAGTCACTGACCAATCT628620.5169270544236315Illumina PCR Primer Index 4 (100% over 22bp)
ACCCTGTAGAACCGAATTTGCG579470.47651000640587593No Hit
CTGTCTGAGGGTCGCT578640.4758274804678346No Hit
CTACGCCTGTCTGAGGGTCGCT556830.4578926723850828No Hit
TTCAAGTAATCCAGGATAGGTT467790.38467326332097385No Hit
CCACGTTCCCGTGG457910.3765487376970588No Hit
TTCACAGTGGTTAAGTTCTGCC453770.37314433121092433No Hit
TTCACAGTGGCTAAGTTCTG451530.37130233349861974No Hit
TATGTGCCCTTGGACTACATCG445230.36612171493276296No Hit
AAGCTGCCAGCTGAAGAACTGC442490.3638685570168189No Hit
TCCTTCATTCCACCGGAGTCT430770.35423096184351077No Hit
TTCACAGTGGCTAAGTTCTGC421790.34684652458614673No Hit
AACTCCAGTCACTGACCAATCTCGTATGC418120.3438286086914333Illumina PCR Primer Index 4 (100% over 29bp)
TAACGGAACCCATAATGCAGCTG411520.33840129400339286No Hit
TGAGGTAGTAGTTTGTATAGTT394270.32421626697783273No Hit
ATGACCTATGAATTGACAGCC375070.30842771515807876No Hit
AAGCTGCCAGCTGAAGAACT372650.30643769977246393No Hit
TTAGGTAGTAGGTTGTATAGTT365160.3002785199219453No Hit
TTCCCTTTGTCATCCTATGCCTG355190.2920799854613752No Hit
AACATTCATTGCTGTCGGTGGG349940.28776280332316123No Hit
TGTCTGAGGGTCGCT343270.2822779262066113No Hit
ACCCTGTAGAACCGAATTTGTG335300.27572403256059885No Hit
TACCCTGTAGAACCGAATGTGT317250.26088114920921557No Hit
AACATTCATTGCTGTCGGTGGGT316010.2598614719041898No Hit
CACCACGTTCCCGTGG315770.2596641150064429No Hit
ATGACCTATGAATTGACAGCCA305070.25086528664855917No Hit
AACTCCAGTCACTGACCAATCTC287910.23675426845965408Illumina PCR Primer Index 4 (100% over 23bp)
TTCACAGTGGCTAAGTTCAGT285020.2343777624826182No Hit
TTTGGTCCCCTTCAACCAGCTG275860.22684530755194393No Hit
TACCCTGTAGATCCGGATTTGT274480.22571050538989912No Hit
ACAGTAGTCTGCACATTGGTTA274320.22557893412473448No Hit
TACAGTAGTCTGCACATTGGTT267260.2197733520493458No Hit
TGGACGGAGAACTGATAAGGGC264940.21786556870445886No Hit
TGAGATGAAGCACTGTAGCTC261310.21488054562603665No Hit
TTCAGTCATTGTTTCTGGTTGT259230.21317011917889664No Hit
TGTAAACATCCTTGACTGGAAGCT248030.2039601306173735No Hit
TTCACAGTGGTTAAGTTCTGC238850.19641122927855365No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT231440.19031783506061736No Hit
CGCCTTGAAGCCCGGTTGCCGGCCCG229690.18887877434787936No Hit
TATCTTATCAGACTGGTGTTGGC216120.17771988642110534No Hit
AACCCGTAGATCCGAACTTGTG206740.17000652100082972No Hit
AACATTAAGAGTTTATGTGCTG202670.1666596769432048No Hit
TTCAAGTAATCCAGGATAGGC197800.1626549765597568No Hit
CATTGCACTTGTCTCGGTCTGA189100.1555007890164308No Hit
TGAGGTAGTAGATTGAATAGTT187950.15455512054806012No Hit
AACTCCAGTCACTGACCAATCTCG186970.15374924654892683Illumina PCR Primer Index 4 (100% over 24bp)
CCTGTCTGAGGGTCGCTT185740.15273779244797386No Hit
TACCCTGTAGAACCGAATTTGTG185040.15216216816287864No Hit
TACGCCTGTCTGAGGGTCGCT174880.14380739282492552No Hit
ACCACGTTCCCGTGG173140.1423765553162603No Hit
TGTAAACATCCTACACTCTCAGCT173120.14236010890811474No Hit
TATTGCACTTGTCCCGGCCTGTT172790.14208874317371273No Hit
TAGCTTATCAGACTGGTGTTGGCT170330.14006583497180675No Hit
CCGGGTGCCGTAGACTT167940.13810048919841028No Hit
CCCAGTGTTCAGACTACCTGTTC165590.136168036241305No Hit
TTCACGTAATCCAGGATAGGCT163130.13414512803939901No Hit
CCTTTCTGAGGGTCGCT160710.13215511265378418No Hit
TGTAAACATCCCCGACTGGAAGCT158300.13017332047224214No Hit
CTGGACAACTCTTAGCGG158170.1300664188192959No Hit
TTCAAGTAATCCAGGATGGGCT156560.12874248296357696No Hit
TGAGGTAGTAGGTTGTATAGT152610.1254943173548255No Hit
CATTATTACTTTTGGTACGCG150900.12408814945837866No Hit
ACCATCGACCGTTGACTGTACC147540.12132515288992173No Hit
AAGTTCTGTGATACACTTTGACT146150.12018212752380411No Hit
TCCCTGAGACCCTTAACCTGTGA145040.11926935187172459No Hit
ACCGGGTGCCGTAGACTT143820.11826612097484439No Hit
TAGCAGCACGTAAATATTGGAG143230.11778095193454988No Hit
AACATTCAACGCTGTCGGTGAGTT141660.11648990889512208No Hit
TCCCTGAGACCCTTAACCTGTG140290.11536332993715005No Hit
AAGTTCTGTGATACACTCAGACT137990.1134719930004087No Hit
CCTTGAAGCCCGGTTGCCGGCCCG134360.11048696992198646No Hit
ACAGCAGGCACAGACAGGCAGT133490.10977155116765386No Hit
TGAGGTAGTTGGTTGTATAGTT131180.10787199102683973No Hit
TGAGGTAGTAGTTTGTGCTGTT130760.1075266164557826No Hit
TTCACAGTGGTTAAGTTCTGCCT128620.10576685078420586No Hit
TGAGGTAGTAGGTTGTATAGTTT127970.1052323425194746No Hit
TATTTCACTTGTCCCGGCCTGT126660.10415510278593931No Hit
TACCCTGTAGATCCGGATTTGTG126580.10408931715335701No Hit
AATATTCAACGCTGTCGGTGAG126240.10380972821488219No Hit
TGAGTTAGTAGGTTGTATAGTT124440.10232955148178026No Hit
ACCCTGTAGAACCGAATTTGTGT121900.10024085764729197No Hit
TGAGATGAAGCACTGTAGCTCT121760.10012573279027295No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATTC50.0076527841034.156223
CGTATGC48600.01002.237823
GATTCCT30750.0882.816223
TAACTGC1850.0838.5050723
CAACCCG1500.0689.4374423
GCATTCG351.9244908E-9590.946423
TCGTATG50400.0571.733122
GGACACT2250.0551.549923
ACAACCC5150.0527.0852722
AATGCTC20750.0508.8993222
ATAACTA1700.0491.3102722
GGATTCC45300.0482.0139522
TCTGACT19950.0458.76123
TGGGGGC351.4229736E-6443.2097823
AGTTGCC4050.0419.823322
CACAAAC253.072499E-4413.6624823
GACAACC8950.0408.0187721
TCACGCT301.3907993E-8397.727422
GTATGCC1450.0392.2661423
AATAACC800.0387.8085623