FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_5_JG19_5_ACAGTG_L005_R1_001_TRIMMED_prinseq_good_94wz.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_5_JG19_5_ACAGTG_L005_R1_001_TRIMMED_prinseq_good_94wz.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9857454
Sequences flagged as poor quality0
Sequence length12-29
%GC49

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG6048226.135681688192509No Hit
TAGCTTATCAGACTGGTGTTGGC5868295.953149768692809No Hit
AACATTCAACGCTGTCGGTGAGT4760544.829380892875585No Hit
CCTGTCTGAGGGTCGCT3259143.306269549926381No Hit
TTCAAGTAATCCAGGATAGGCT3199153.245412050616721No Hit
TACCCTGTAGAACCGAATTTGT3069853.1142422779756314No Hit
TCCTTCATTCCACCGGAGTCTG2586652.624054852297561No Hit
TGAGGTAGTAGGTTGTATAGTT2454152.4896388053142324No Hit
AAGCTGCCAGCTGAAGAACTGT2234732.2670458315098405No Hit
TTCCCTTTGTCATCCTATGCCT2225742.2579258295296127No Hit
TATTGCACTTGTCCCGGCCTGT1553671.576137205408212No Hit
AACAGTAAGAGTTTATGTGCTG1274411.2928389014039527No Hit
TACCCTGTAGAACCGAATTTGCG1143951.1604923543138015No Hit
AACATTCAACGCTGTCGGTGA917510.9307778661711228No Hit
TCCTTCATTCCACCGGAGTCTGT842460.8546425882383017No Hit
CTACGCCTGTCTGAGGGTCGCT788980.8003892282936345No Hit
CTGTCTGAGGGTCGCT742750.7534907086556022No Hit
ACAGTAGTCTGCACATTGGTT694560.7046038459829486No Hit
TACCCTGTAGAACCGAATTTGC687610.6975533438958984No Hit
TGTCTGAGGGTCGCT601960.610664782204411No Hit
TTGGTCCCCTTCAACCAGCTGT566870.5750673551202978No Hit
TAACGGAACCCATAATGCAGCTG559870.5679661299966503No Hit
TGAGGTAGTAGTTTGTATAGTT534200.5419249230075027No Hit
TATGTGCCCTTGGACTACATCG509030.5163909463843301No Hit
TTCACAGTGGTTAAGTTCTG504080.5113693657611793No Hit
TAGCTTATCAGACTGGTGTTGG482270.48924397719735746No Hit
CCTTTCTGAGGGTCGCT463770.470476453656289No Hit
AACTCCAGTCACACAGTGATCT432710.43896730332193284Illumina PCR Primer Index 5 (100% over 22bp)
TTTGGTCCCCTTCAACCAGCTGT421190.42728071568987286No Hit
TTCACAGTGGCTAAGTTCTG412500.41846505192923045No Hit
TTCCCTTTGTCATCCTATGCCTG401940.4077523465998421No Hit
ACCCTGTAGAACCGAATTTGCG399390.4051654717333705No Hit
TTCACAGTGGCTAAGTTCTGC393530.3992207318441456No Hit
AAGCTGCCAGCTGAAGAACTGC391670.3973338348827192No Hit
TTCAAGTAATCCAGGATAGGTT375860.38129521071059524No Hit
AACATTCATTGCTGTCGGTGGG372630.37801850254639785No Hit
TTCACAGTGGTTAAGTTCTGCC348730.3537728910528013No Hit
AACATTCATTGCTGTCGGTGGGT338840.34373987441381926No Hit
AACTCCAGTCACACAGTGATCTCGTATGC338290.3431819210112469Illumina PCR Primer Index 5 (100% over 29bp)
AAGCTGCCAGCTGAAGAACT334200.33903277661757286No Hit
TGTAAACATCCTTGACTGGAAGCT333570.3383936663564446No Hit
ACCCTGTAGAACCGAATTTGTG318360.32296371862349044No Hit
CACCACGTTCCCGTGG316550.3211275446986615No Hit
TTCACAGTGGCTAAGTTCAGT316180.3207521942278402No Hit
TTCAGTCATTGTTTCTGGTTGT312350.316866809624473No Hit
CCTGTCTGAGGGTCGCTT311220.3157204689973699No Hit
TACAGTAGTCTGCACATTGGTT299620.303952724506754No Hit
TGGACGGAGAACTGATAAGGGC295710.2999861830448309No Hit
CCACGTTCCCGTGG294310.29856593802010134No Hit
TGAGGTAGTAGATTGAATAGTT285140.289263333108123No Hit
TGAGATGAAGCACTGTAGCTC282320.286402553844025No Hit
ACAGTAGTCTGCACATTGGTTA266890.27074942475004193No Hit
TGTAAACATCCTACACTCTCAGCT244680.24821825189344024No Hit
TGTAAACATCCCCGACTGGAAGCT228390.23169268656998043No Hit
TCCTTCATTCCACCGGAGTCT214070.21716560888846145No Hit
TATTGCACTTGTCCCGGCCTGTT212210.21527871192703513No Hit
TGAGGTAGTAGTTTGTGCTGTT209940.21297588606550938No Hit
TACCCTGTAGAACCGAATTTGTG207120.21011510680141143No Hit
AACTCCAGTCACACAGTGATCTC206730.20971946711595105Illumina PCR Primer Index 5 (100% over 23bp)
CATTGCACTTGTCTCGGTCTGA206380.20936440585976865No Hit
TACGCCTGTCTGAGGGTCGCT198870.20174580576282677No Hit
TGAGGTAGTAGGTTGTATAGT190300.1930518772900183No Hit
AACCCGTAGATCCGAACTTGTG188540.1912664264017869No Hit
GGACAACTCTTAGCGG185720.1884056471376889No Hit
TTCACAGTGGTTAAGTTCTGC182890.1855347232662714No Hit
CCCAGTGTTCAGACTACCTGTTC176120.17866682411097226No Hit
CACGTTCCCGTGG168600.1710380794067109No Hit
CGCCTTGAAGCCCGGTTGCCGGCCCG168000.1704294029675411No Hit
ACCATCGACCGTTGACTGTACC166140.16854250600611476No Hit
TACCCTGTAGAACCGAATGTGT164960.16734544234241416No Hit
CAGTCGGTAGAGCATC162710.16506290569552748No Hit
ACCACGTTCCCGTGG156890.1591587442355805No Hit
AACTCCAGTCACACAGTGATCTCG155270.15751531784982206Illumina PCR Primer Index 5 (100% over 24bp)
TTCAAGTAATCCAGGATAGGC155270.15751531784982206No Hit
CATTATTACTTTTGGTACGCG154910.1571501119863202No Hit
TGAGGTAGTAGGTTGTATAGTTT153970.15619651889828753No Hit
AACATTCAACGCTGTCGGTGAGTT152680.1548878645540725No Hit
TAGCAGCACGTAAATATTGGAG151970.1541675974343882No Hit
AAGTTCTGTGATACACTTTGACT149800.15196621764605747No Hit
CTGGACAACTCTTAGCGG148680.15083002162627387No Hit
TGAGGTAGTTGGTTGTATAGTT145050.14714752916929666No Hit
TAGCTTATCAGACTGGTGTTGGCT142720.14478383566385397No Hit
TGAGAACTGAATTCCATAGATGG134540.13648554687650583No Hit
TACCCTGTAGATCCGGATTTGT132460.13437546855405055No Hit
TGTAAACATCCCCGACTGGAAGC131810.13371606907828332No Hit
AGCTACATCTGGCTACTGGGTCTC128980.1308451452068658No Hit
TGAGGTAGTAGGTTGTGTGGTT128270.13012487808718154No Hit
TCCCTGAGACCCTTAACCTGTGA127770.1296176477212067No Hit
TGATGTAGTAGGTTGTATAGTT126520.12834957180626966No Hit
AAGTTCTGTGATACACTCAGACT122420.1241902828052761No Hit
TTTGGTCCCCTTCAACCAGCTG121460.12321640050260442No Hit
AACATTCAACGCTGTCGGTGG118580.12029475359458944No Hit
ACCATCGACCGTTGACTGTGCC117950.11965564333346115No Hit
CCTTGAAGCCCGGTTGCCGGCCCG115060.11672385181812667No Hit
AACATTCATTGCTGTCGGTGGGTT114570.11622676605947133No Hit
TCACAGTGAACCGGTCTCTTT113890.11553693276174558No Hit
TATTGCACTTGTCCCGGCCTGTTT112820.11445145977855946No Hit
TGAGATGAAGCACTGTAGCTCT112310.11393408480526512No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT111310.11291962407331549No Hit
ACCCTGTAGAACCGAATTTGTGT110870.11247326135125763No Hit
TTATGTAGTAGGTTGTATAGTT110240.11183415109012937No Hit
TCCCTGAGACCCTTAACCTGTG107810.10936901151149173No Hit
AAGGTCCAACCTCACATGTCCT107200.10875019046500242No Hit
CCCAGTGTTCAGACTACCTGTTCT106190.10772558512573327No Hit
TACGACCTCAGATCAGACGA104940.10645750921079622No Hit
TCCAGCATCAGTGATTTTGTTG104530.10604158031069687No Hit
ACTGGACAACTCTTAGCGG104100.10560536219595851No Hit
ACAGCAGGCACAGACAGGCAGT104050.10555463915936103No Hit
GAAGGATCATTA103030.10451988921277239No Hit
TACCCTGTAGAACCGAATTTG99230.10066493843136372No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCCCACA50.00478239641308.18223
CGTATGC34800.01281.86823
CAACCCG2000.01144.659323
TAACTAA251.10958354E-101046.545723
TAACTGC1350.01017.4748523
GATTCCT15700.0983.219623
AATAACC500.0915.727423
GCATTCG153.28338E-5872.1213423
GCTTCCT1050.0809.8269723
ACACCTT204.1472958E-10803.2272322
CACGCAA104.2042524E-5803.2272322
TCGTATG36050.0779.832222
ATAACTA1500.0749.678722
GACACGC451.8189894E-12726.7677623
ACAACCC5650.0717.928722
GACGTTC550.0713.553823
TAAAAAA207.778372E-5654.09123
GTATGCC800.0654.09123
AAAGGCC303.0021147E-7654.09123
ATCACTA251.2660166E-9642.581722