FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_5_JG21_5_TTAGGC_L003_R1_001_TRIMMED_prinseq_good_VYqn.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_5_JG21_5_TTAGGC_L003_R1_001_TRIMMED_prinseq_good_VYqn.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10643482
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG5457425.127476139857238No Hit
AACATTCAACGCTGTCGGTGAGT4715794.430683492488642No Hit
TAGCTTATCAGACTGGTGTTGGC4069703.8236547024742467No Hit
TTCAAGTAATCCAGGATAGGCT3556853.3418105090044783No Hit
TACCCTGTAGAACCGAATTTGT3112182.924024299566627No Hit
CCTGTCTGAGGGTCGCT2881532.707318901840582No Hit
TGAGGTAGTAGGTTGTATAGTT2280002.1421561101902555No Hit
TCCTTCATTCCACCGGAGTCTG2016461.8945491710325624No Hit
TTCCCTTTGTCATCCTATGCCT1928551.8119540203102704No Hit
AACAGTAAGAGTTTATGTGCTG1889731.7754809939078207No Hit
AAGCTGCCAGCTGAAGAACTGT1883571.7696934142416927No Hit
GCATCGATGGTTCAGTGGTAGAATGCTC1634591.5357662088403023No Hit
TATTGCACTTGTCCCGGCCTGT1491801.4016089847288697No Hit
TACCCTGTAGAACCGAATTTGCG1455451.3674566274457927No Hit
TTGGTCCCCTTCAACCAGCTGT1097011.0306871379121982No Hit
TACCCTGTAGAACCGAATTTGC1073101.0082226850198084No Hit
ACAGTAGTCTGCACATTGGTT926980.8709367855369136No Hit
TTTGGTCCCCTTCAACCAGCTGT848820.7975021708121459No Hit
CTACGCCTGTCTGAGGGTCGCT825260.7753665576735133No Hit
AACATTCAACGCTGTCGGTGA795820.7477064366717584No Hit
CTGTCTGAGGGTCGCT687680.646104348182296No Hit
ACCCTGTAGAACCGAATTTGCG661820.6218077880904013No Hit
TGTCTGAGGGTCGCT647410.6082689856571374No Hit
TCCTTCATTCCACCGGAGTCTGT621540.5839630301437068No Hit
CCACGTTCCCGTGG598480.5622971880818702No Hit
AACTCCAGTCACTTAGGCATCT532320.5001370792002091Illumina PCR Primer Index 3 (100% over 22bp)
TAGCTTATCAGACTGGTGTTGG471420.4429189620464431No Hit
TGAGGTAGTAGTTTGTATAGTT469960.44154723050219846No Hit
TAACGGAACCCATAATGCAGCTG454250.4267870232692647No Hit
TTCACAGTGGTTAAGTTCTG453480.4260635758109987No Hit
TTCACAGTGGCTAAGTTCTG435290.40897330403715626No Hit
CCTTTCTGAGGGTCGCT429050.40311056099874076No Hit
TTCACAGTGGCTAAGTTCTGC426170.40040467959639525No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT399260.3751216002432287No Hit
AACTCCAGTCACTTAGGCATCTCGTATGC389850.3662805085779259Illumina PCR Primer Index 3 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTGC386020.3626820621296677No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC367670.34544146361125055No Hit
TACAGTAGTCTGCACATTGGTT363940.34193697137835155No Hit
TTCACGTAATCCAGGATAGGCT337250.3168605912989753No Hit
TATGTGCCCTTGGACTACATCG333430.313271540272253No Hit
TTCAAGTAATCCAGGATAGGTT330450.3104717046545482No Hit
ACAGTAGTCTGCACATTGGTTA326170.30645046423717354No Hit
AACTCCAGTCACTTAGGCATCTC325200.30553910834818904Illumina PCR Primer Index 3 (100% over 23bp)
TGTAAACATCCTTGACTGGAAGCT324060.30446803029309394No Hit
AAGCTGCCAGCTGAAGAACT320450.301076283118626No Hit
TGAGATGAAGCACTGTAGCTC319960.30061590746336586No Hit
TTCCCTTTGTCATCCTATGCCTG316250.2971302060735387No Hit
ACCCTGTAGAACCGAATTTGTG314290.29528870345249797No Hit
CACCACGTTCCCGTGG310790.2920003059149252No Hit
TTTGGTCCCCTTCAACCAGCTG303520.2851698344583098No Hit
TACCCTGTAGAACCGAATGTGT298530.2804815191118846No Hit
AACTCCAGTCACTTAGGCATCTCG296910.2789594608230652Illumina PCR Primer Index 3 (100% over 24bp)
TTCACAGTGGCTAAGTTCAGT288740.27128340142821683No Hit
TGATGTAGTAGGTTGTATAGTT283780.26662327234639943No Hit
AACATTCATTGCTGTCGGTGGG275850.2591727030684131No Hit
AACATTCATTGCTGTCGGTGGGT262730.24684591001328327No Hit
TGGACGGAGAACTGATAAGGGC253230.2379202595541572No Hit
CATTGCACTTGTCTCGGTCTGA238080.2236861959272351No Hit
TTCACAGTGGTTAAGTTCTGCC237940.22355466002573218No Hit
CCTGTCTGAGGGTCGCTT237590.2232258202719749No Hit
TCCTTCATTCCACCGGAGTCT212570.19971847558909764No Hit
TACCCTGTAGATCCGGATTTGT212040.19922051824769377No Hit
TGAGGTAGTAGGTTGTATAGT208760.19613881998391128No Hit
TGTAAACATCCCCGACTGGAAGCT207330.1947952747042744No Hit
TGAGGTAGTAGATTGAATAGTT195360.18354895512577557No Hit
TGAGGTAGTAGTTTGTGCTGTT194120.18238392285532123No Hit
TATTGCACTTGTCCCGGCCTGTT191980.18037330264663387No Hit
TACCCTGTAGAACCGAATTTGTG189740.17826872822258732No Hit
TGTAAACATCCTACACTCTCAGCT186640.17535614754645143No Hit
TACCATGTAGAACCGAATTTGT182750.1717013285689777No Hit
CACGTTCCCGTGG180640.16971889462489814No Hit
TTCAAGTAATCCAGGATAGGC179510.16865721199133893No Hit
ACCACGTTCCCGTGG174810.1642413638694555No Hit
TTCAGTCATTGTTTCTGGTTGT174570.16401587375259336No Hit
AACCCGTAGATCCGAACTTGTG170740.16041742730433517No Hit
GTGTAATGGTTAGCACTCTG167510.15738270614823233No Hit
CCCAGTGTTCAGACTACCTGTTC166330.1562740464069935No Hit
TGAGGTAGTAGGTTGTATAGTTT165860.15583246159480516No Hit
GTTCGATTCCCGGTACCG161410.15165149901131977No Hit
TACGCCTGTCTGAGGGTCGCT161370.1516139173251761No Hit
GAAGGATCATTA161220.15147298600213727No Hit
TTCACAGTGGTTAAGTTCTGC160630.15091865613151786No Hit
TGAGATGAAGCACTGTAGCTCT158350.1487765000213276No Hit
CTGGACAACTCTTAGCGG150570.14146686206638015No Hit
TTGTTCCCCTTCAACCAGCTGT149500.1404615519620365No Hit
TCCAGCATCAGTGATTTTGTTG146900.13801874236269673No Hit
TTAGGTAGTAGGTTGTATAGTT142780.13414782868989678No Hit
CATTATTACTTTTGGTACGCG140150.13167683282594925No Hit
TCCCTGAGACCCTTAACCTGTG140100.13162985571826966No Hit
TTCAAGTAATCCAGGATGGGCT139490.1310567350045784No Hit
ACATTAGTCTGCACATTGGTT138970.13056817308471044No Hit
TCCTCGGTAGTATAGTGGTCAGTATCCCC138900.13050240513395897No Hit
TGAGGTAGTTGGTTGTATAGTT134550.12641539676583283No Hit
AACATTCAACGCTGTCGGTGAGTT132060.12407593680338821No Hit
TCCCTGAGACCCTTAACCTGTGA131920.12394440090188531No Hit
TACCCTGTAGAACCGAATTTG127400.11969767036764849No Hit
TACCCTGTAGATCCGGATTTGTG125750.11814742581422132No Hit
GGACAACTCTTAGCGG122350.11495298249200778No Hit
ACCCTGTAGAACCGAATTTGTGT121370.1140322311814874No Hit
CCCAGTGTTCAGACTACCTGTT119550.11232226446194957No Hit
TGTAAACATCCCCGACTGGAAGC119180.11197463386512045No Hit
AAGTTCTGTGATACACTTTGACT113370.10651589395274967No Hit
ACTGGACAACTCTTAGCGG113340.1064877076881419No Hit
GCATTGTGGTTCAGTGGTAGAATTCTC112890.1060649137190254No Hit
TTCCATTTGTCATCCTATGCCT112430.10563272432837299No Hit
TTTTGTCCCCTTCAACCAGCTGT111210.1044864829009905No Hit
AAGTTCTGTGATACACTCAGACT109000.10241009474155169No Hit
AGCTACATCTGGCTACTGGGTCTC108820.1022409771539051No Hit
TTCAAGTAATCCAGGATAGGCTT107800.10128264415724103No Hit
CCCAGTGTTCAGACTACCTGTTCT107000.10053101043436725No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC40450.0630.831223
GATTCCT47400.0582.406223
CACGTGT1550.0518.3456423
TAACTGC2400.0401.717923
AATAACC1150.0391.238323
GACCCCA2800.0355.8072823
TATCCCC25250.0355.1027223
GGGCACG206.547097E-4321.3743323
TAACTAA503.1832315E-10321.3743323
ATTCGGC16850.0307.0698223
ATCGGGC7650.0306.6709323
CGCATTG950.0304.459923
ATGCTCG1650.0292.1584823
CAACCCG1700.0283.5655823
AAATAGC1900.0270.63123
CACGTCT2850.0270.63123
TTCTCGC22550.0262.2300723
CCCGCCT1750.0257.0994623
TCGTATG41550.0255.8354322
AATGCTC198900.0252.4574922