FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_5_JG25_5_CGATGT_L002_R1_001_TRIMMED_prinseq_good_pfdd.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_5_JG25_5_CGATGT_L002_R1_001_TRIMMED_prinseq_good_pfdd.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20809019
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG9613004.619631516507337No Hit
ATGACCTATGAATTGACAGCC9019894.334606066725202No Hit
TAGCTTATCAGACTGGTGTTGGC8341254.008478246860172No Hit
ATGACCTATGAATTGACAGCCA8263733.971225169240318No Hit
AACATTCAACGCTGTCGGTGAGT8177953.9300026589432204No Hit
TTCAAGTAATCCAGGATAGGCT7391803.5522097413626277No Hit
TCCTTCATTCCACCGGAGTCTG5409522.599603566126784No Hit
TACCCTGTAGAACCGAATTTGT4317012.074586024454108No Hit
AACAGTAAGAGTTTATGTGCTG3876491.8628893558124964No Hit
AAGCTGCCAGCTGAAGAACTGT3788471.8205903891961461No Hit
CCTGTCTGAGGGTCGCT3045101.4633558650698526No Hit
TGAGGTAGTAGGTTGTATAGTT3019641.451120785655489No Hit
TTCCCTTTGTCATCCTATGCCT3016211.4494724619166333No Hit
TATTGCACTTGTCCCGGCCTGT2450771.1777441310424102No Hit
TACCCTGTAGAACCGAATTTGCG2045320.9829007316490989No Hit
TCCTTCATTCCACCGGAGTCTGT1931310.9281119883642761No Hit
TACCCTGTAGAACCGAATTTGC1661180.798298084114393No Hit
ACAGTAGTCTGCACATTGGTT1547350.7435958417837957No Hit
AACATTCAACGCTGTCGGTGA1529920.7352196660496105No Hit
CTACGCCTGTCTGAGGGTCGCT1409030.6771246640699401No Hit
CCTTTCTGAGGGTCGCT1327220.6378099803743752No Hit
TTGGTCCCCTTCAACCAGCTGT1321930.6352678134418542No Hit
TTCACAGTGGTTAAGTTCTG1233250.5926516766600097No Hit
TTCACGTAATCCAGGATAGGCT1143980.5497520089726479No Hit
TTTGGTCCCCTTCAACCAGCTGT1065190.511888619064647No Hit
TAGCTTATCAGACTGGTGTTGG1056120.507529932093387No Hit
ACCCTGTAGAACCGAATTTGCG970430.4663506722734022No Hit
CTGTCTGAGGGTCGCT951710.457354573033933No Hit
ATGAACTATGAATTGACAGCC884630.42511855075916843No Hit
TTCACAGTGGCTAAGTTCTG875010.4204955553166634No Hit
CCACGTTCCCGTGG867830.417045128364773No Hit
TTCACAGTGGCTAAGTTCTGC858470.4125470787450384No Hit
TTAGGTAGTAGGTTGTATAGTT849600.4082845039451403No Hit
ATGAACTATGAATTGACAGCCA801690.3852608332954091No Hit
TTCAAGTAATCCAGGATAGGTT799880.3843910181445843No Hit
TTATGTAGTAGGTTGTATAGTT796170.382608137365822No Hit
TACAGTAGTCTGCACATTGGTT766900.3685421210870152No Hit
TGATGTAGTAGGTTGTATAGTT732020.3517801584015085No Hit
AACTCCAGTCACCGATGTATCT705590.33907893495603997Illumina PCR Primer Index 2 (100% over 22bp)
TTCACAGTGGCTAAGTTCAGT699960.3363733773322039No Hit
TTCACAGTGGTTAAGTTCTGCC693500.33326895419721614No Hit
TAACGGAACCCATAATGCAGCTG682580.3280212296408591No Hit
AAGCTGCCAGCTGAAGAACTGC672910.32337420615551365No Hit
TGTCTGAGGGTCGCT647840.3113265454753057No Hit
TGAGGTAGTAGTTTGTATAGTT638250.30671796685850494No Hit
ACATTAGTCTGCACATTGGTT610010.2931469282622117No Hit
TGAGATGAAGCACTGTAGCTC592460.28471308522520933No Hit
AAGCTGCCAGCTGAAGAACT570310.27406866224688436No Hit
ATGACCTATGAATTGACAGCCAT556540.267451339248621No Hit
TTGTTCCCCTTCAACCAGCTGT505050.24270726073151264No Hit
TGAGATGAAGCACTGTAGCTCT491820.23634944059592622No Hit
ACAGTAGTCTGCACATTGGTTA491150.236027464821864No Hit
TCCTTCATTCCACCGGAGTCT485950.23352854836645592No Hit
CATTGCACTTGTCTCGGTCTGA476530.22900166509531275No Hit
AACATTCATTGCTGTCGGTGGG476000.22874696784120385No Hit
TATGTGCCCTTGGACTACATCG472070.2268583636739435No Hit
TTCAGTCATTGTTTCTGGTTGT471070.22637780281713427No Hit
TTCACAGTGGTTAAGTTCTGC467340.22458531082123573No Hit
AACTCCAGTCACCGATGTATCTCGTATGC457110.2196691732560771Illumina PCR Primer Index 2 (100% over 29bp)
TGTAACAGCAACTCCATGTGGA456650.21944811526194483No Hit
TACCCTGTAGATCCGGATTTGT440170.2115284723417284No Hit
AACTCCAGTCACCGATGTATCTCG426250.20483906521494358Illumina PCR Primer Index 2 (100% over 24bp)
AACATTCATTGCTGTCGGTGGGT419920.201797114991341No Hit
TACCATGTAGAACCGAATTTGT414550.1992165031902753No Hit
TTTTGTCCCCTTCAACCAGCTGT395820.19021559834223803No Hit
ACCCTGTAGAACCGAATTTGTG395630.1901242917794443No Hit
TTCCCTTTGTCATCCTATGCCTG393530.18911511398014486No Hit
TACCCTGTAGAACCGAATGTGT377050.1811954710599284No Hit
ATGACCTATGAATTGACAGC376290.18083024480875337No Hit
ATGACCTATGAATTGACAGCCT373440.179460646366847No Hit
TCCAGCATCAGTGATTTTGTTG371610.17858121999888607No Hit
TGTAAACATCCTTGACTGGAAGCT368660.17716356547129877No Hit
AACTCCAGTCACCGATGTATCTC360460.1732229664454629Illumina PCR Primer Index 2 (100% over 23bp)
TTCAAGTAATCCAGGATAGGC357030.17157464270660716No Hit
TATTGCACTTGTCCCGGCCTGTT351590.16896039164556484No Hit
CACCACGTTCCCGTGG336440.16167989466490468No Hit
TTTCTGAGGGTCGCT302940.14558110596179474No Hit
TGAGGTAGTAGGTTGTATAGT299840.14409136730568606No Hit
TGGACGGAGAACTGATAAGGGC297850.14313505120063563No Hit
CATTATTACTTTTGGTACGCG295380.1419480658843168No Hit
TTTGGTCCCCTTCAACCAGCTG292660.14064094035379562No Hit
TAGCAGCACGTAAATATTGGAG278870.13401400613839604No Hit
TGAGGTAGTAGGTTGTATAGTTT275020.13216384683968044No Hit
AACCCGTAGATCCGAACTTGTG272880.13113544660610862No Hit
TTCCATTTGTCATCCTATGCCT271360.13040499410375855No Hit
TTCAAGTAATCCAGGATAGGCTT262990.12638269973226512No Hit
TGTAAACATCCTACACTCTCAGCT260530.12520052002451437No Hit
AACACTCAACGCTGTCGGTGAG257820.12389820010256129No Hit
TGAGGTAGTAGATTGAATAGTT254360.12223545953800127No Hit
ACCACGTTCCCGTGG241050.11583919453387014No Hit
TAGCCTATCAGACTGGTGTTGGC232130.11155259169113162No Hit
CACGTTCCCGTGG231770.11137958978268028No Hit
TTCAAGTAATCCAGGATGGGCT230900.11096150183725624No Hit
TACCCTGTAGATCCGGATTTGTG227000.10908731449570015No Hit
TAGCTTATCAGACTGGTGTTGGCT225540.10838569564475865No Hit
TCCCTGAGACCCTTAACCTGTG220880.10614628205202754No Hit
AACACTCAACGCTGTCGGTGAGT218490.10499774160425343No Hit
TACCCTGTAGAACCGAATTTGTG218300.10490643504145966No Hit
AAGTTCTGTGATACACTCAGACT217720.1046277097445103No Hit
CCCAGTGTTCAGACTACCTGTTC216310.10395011893640925No Hit
TACAGTACTGTGATAACTGAAG213740.10271507753440948No Hit
TTCACAGTGGTTAAGTTCTGCCT212380.10206151476914889No Hit
TCCAGCATCAGTGATTTTGTT212020.10188851286069757No Hit
TACGCCTGTCTGAGGGTCGCT208120.10001432551914148No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC48750.01668.258923
GATTCCT17000.01345.336923
TAACTGC4850.01073.330123
AATAACC1750.01072.827323
TCGTATG51200.0959.237722
TAACTAA1350.0948.2059323
ATAACTA10550.0931.0514522
ACAACCC5800.0889.541722
GGATTCC25200.0813.037322
CGCATGC256.844742E-5682.7082523
TAATAAC2900.0667.1562522
TCTGACT57050.0653.6886623
TTCTCGC37050.0651.8435723
CTCGTAT75100.0627.6969621
AAATAGC4350.0608.1596723
GCATAGC2450.0587.209222
CGATAAC41100.0560.458520
TCTCGTA78550.0552.2397520
GGACACT1900.0538.980223
GGCTCGT2300.0519.4519723