FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_5_JG35_5_ATCACG_L001_R1_001_TRIMMED_prinseq_good_xCky.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_5_JG35_5_ATCACG_L001_R1_001_TRIMMED_prinseq_good_xCky.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11466251
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG5346544.662849260843846No Hit
AACATTCAACGCTGTCGGTGAGT4534993.95507651105841No Hit
TTCAAGTAATCCAGGATAGGCT4255683.7114833784817725No Hit
TAGCTTATCAGACTGGTGTTGGC3731663.2544726257954757No Hit
ATGACCTATGAATTGACAGCC2925802.5516622651989738No Hit
TACCCTGTAGAACCGAATTTGT2790622.4337684566646938No Hit
ATGACCTATGAATTGACAGCCA2506122.1856489972180095No Hit
TTCCCTTTGTCATCCTATGCCT2478922.1619272070705584No Hit
AAGCTGCCAGCTGAAGAACTGT2200041.9187090880881643No Hit
CCTGTCTGAGGGTCGCT1971731.7195943120379975No Hit
AACAGTAAGAGTTTATGTGCTG1834791.6001655641412351No Hit
TCCTTCATTCCACCGGAGTCTG1456991.270676875990243No Hit
TATTGCACTTGTCCCGGCCTGT1261701.1003596554793715No Hit
TGAGGTAGTAGGTTGTATAGTT1173871.0237609485436872No Hit
TACCCTGTAGAACCGAATTTGCG1158141.010042427991503No Hit
TTGGTCCCCTTCAACCAGCTGT1141370.9954168978160342No Hit
TACCCTGTAGAACCGAATTTGC914920.7979242735921269No Hit
TTTGGTCCCCTTCAACCAGCTGT912820.7960928118528018No Hit
CCTTTCTGAGGGTCGCT883320.7703651350384707No Hit
AACATTCAACGCTGTCGGTGA813030.709063494249341No Hit
CTACGCCTGTCTGAGGGTCGCT744700.6494712177502481No Hit
CTGTCTGAGGGTCGCT714560.6231853811677418No Hit
ACAGTAGTCTGCACATTGGTT629790.5492553756236455No Hit
TTCACGTAATCCAGGATAGGCT619830.540569014231417No Hit
ACCCTGTAGAACCGAATTTGCG562180.4902910288637498No Hit
AACTCCAGTCACATCACGATCT550410.4800261218771506Illumina PCR Primer Index 1 (100% over 22bp)
TCCTTCATTCCACCGGAGTCTGT511260.44588244230830115No Hit
TTGTTCCCCTTCAACCAGCTGT509480.44433006045306356No Hit
TTCACAGTGGCTAAGTTCTG506550.44177473526438593No Hit
TTCACAGTGGCTAAGTTCTGC487690.4253264645959695No Hit
AACTCCAGTCACATCACGATCTCGTATGC454110.39604051925952083Illumina PCR Primer Index 1 (100% over 29bp)
TGTCTGAGGGTCGCT426180.37168207812649484No Hit
TTAGGTAGTAGGTTGTATAGTT421790.36785345096666733No Hit
AAGCTGCCAGCTGAAGAACTGC409030.35672514058867194No Hit
TAGCTTATCAGACTGGTGTTGG405640.3537686380666183No Hit
TTCACAGTGGTTAAGTTCTG399800.3486754301820185No Hit
TTCAAGTAATCCAGGATAGGTT373190.32546819357085416No Hit
TGAGATGAAGCACTGTAGCTC364000.3174533681497117No Hit
TGATGTAGTAGGTTGTATAGTT358770.312892156294154No Hit
TTCCCTTTGTCATCCTATGCCTG355850.3103455523518542No Hit
TAACGGAACCCATAATGCAGCTG345930.30169407594513675No Hit
TTTTGTCCCCTTCAACCAGCTGT334710.29190883750931323No Hit
AAGCTGCCAGCTGAAGAACT333400.29076635423382935No Hit
TACAGTAGTCTGCACATTGGTT320930.2798909600007884No Hit
TTCACAGTGGCTAAGTTCAGT312950.2729314053913524No Hit
ATGAACTATGAATTGACAGCC306840.2676027238545537No Hit
AACTCCAGTCACATCACGATCTCG294830.25712850695488876Illumina PCR Primer Index 1 (100% over 24bp)
AACTCCAGTCACATCACGATCTC290350.2532213885776615Illumina PCR Primer Index 1 (100% over 23bp)
TACCATGTAGAACCGAATTTGT289880.25281148999790776No Hit
ACATTAGTCTGCACATTGGTT289630.2525934588384643No Hit
TTTGGTCCCCTTCAACCAGCTG282990.2468025512436454No Hit
ATGAACTATGAATTGACAGCCA264790.2309298828361598No Hit
ACCCTGTAGAACCGAATTTGTG264160.23038044431436222No Hit
AACATTCATTGCTGTCGGTGGG261090.22770302167639625No Hit
CCACGTTCCCGTGG259080.22595005115447062No Hit
TACCCTGTAGATCCGGATTTGT252700.22038589596547292No Hit
TTCCATTTGTCATCCTATGCCT251060.2189556115595237No Hit
TGAGGTAGTAGTTTGTATAGTT240270.20954538671794296No Hit
AACATTCATTGCTGTCGGTGGGT238570.20806277483372726No Hit
TGAGATGAAGCACTGTAGCTCT237490.20712088022493141No Hit
TTATGTAGTAGGTTGTATAGTT233360.20351900547092508No Hit
AACCCGTAGATCCGAACTTGTG230560.20107705648515806No Hit
TTCACAGTGGTTAAGTTCTGCC229460.20011771938360673No Hit
TACCCTGTAGAACCGAATGTGT222560.19410005938296657No Hit
CACCACGTTCCCGTGG220710.19248662880308479No Hit
CATTGCACTTGTCTCGGTCTGA220020.1918848628030208No Hit
ACAGTAGTCTGCACATTGGTTA216500.18881498407805655No Hit
TTCAAGTAATCCAGGATAGGC209030.18230021303388527No Hit
TTTCTGAGGGTCGCT202680.17676222158402077No Hit
TTCAAGTAATCCAGGATGGGCT197070.17186960236610901No Hit
TGTAAACATCCTTGACTGGAAGCT193060.16837238256863554No Hit
CATTATTACTTTTGGTACGCG189210.16501470271320592No Hit
TATGTGCCCTTGGACTACATCG183720.16022673845182703No Hit
TATTGCACTTGTCCCGGCCTGTT173950.15170608074077568No Hit
CTGGACAACTCTTAGCGG162470.14169408989913093No Hit
TCCTTCATTCCACCGGAGTCT155850.13592062479706749No Hit
TCCAGCATCAGTGATTTTGTTG155240.1353886287680254No Hit
AACATTAAGAGTTTATGTGCTG146510.12777498068025897No Hit
TTCACAGTGGTTAAGTTCTGC145560.12694646227437373No Hit
TACCCTGTAGAACCGAATTTGTG139220.12141719207088698No Hit
TCCCTGAGACCCTTAACCTGTG136840.11934153543298504No Hit
TGTAAACATCCTACACTCTCAGCT136810.11931537169385181No Hit
TTCAAGTAATCCAGGATAGGCTT136180.11876593317205422No Hit
CCCAGTGTTCAGACTACCTGTTC135690.11833859209954499No Hit
CAGTCGGTAGAGCATC134450.11725715754870533No Hit
CCTGTCTGAGGGTCGCTT131530.11471055360640545No Hit
AACACTCAACGCTGTCGGTGAG129540.11297502557723531No Hit
ACCACGTTCCCGTGG128620.1121726709104833No Hit
TTCAGTCATTGTTTCTGGTTGT128460.11203313096843946No Hit
TACCCTGTAGATCCGGATTTGTG124080.10821322505498963No Hit
TGTAAACATCCCCGACTGGAAGCT123350.10757657406941466No Hit
TCCCTGAGACCCTTAACCTGTGA121740.10617245340259863No Hit
TACCATGTAGAACCGAATTTGCG121610.10605907719968802No Hit
TACGCCTGTCTGAGGGTCGCT119460.10418400922847407No Hit
TCCCTGAGACCCTAACTTGTGA118900.10369561943132068No Hit
TACCCTGTAGAACCGAATTTG117940.1028583797790577No Hit
AACTGGACAACTCTTAGCGG115620.10083505061942216No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC50050.01369.28723
GATTCCT8950.0998.4361623
CGCATGC152.638224E-5938.163123
TAACTAA550.0895.519323
TAACTGC2800.0879.527923
TCGTATG52200.0834.791822
AATAACC700.0804.139823
ATAACTA4500.0794.992722
ACAACCC5650.0793.3821422
CGTATAC408.039933E-10703.622323
GGATTCC14600.0652.434522
TAATAAC950.0544.446522
CTCGTAT72150.0515.700921
GACAACC10950.0501.846121
TCTGACT31100.0497.7392623
CGATAAA1500.0484.1973620
GTATGCC1600.0483.7403623
CGATAAC19500.0476.491320
TCTCGTA71950.0472.6989420
CGGGGTG302.1072119E-4469.0815423