FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_7_JG48_5_GCCAAT_L001_R1_001_TRIMMED_prinseq_good_sPUK.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_7_JG48_5_GCCAAT_L001_R1_001_TRIMMED_prinseq_good_sPUK.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15389947
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG7817615.079686109380364No Hit
TTCAAGTAATCCAGGATAGGCT7153264.648008209514951No Hit
AACATTCAACGCTGTCGGTGAGT6082713.9523917788670744No Hit
TTCCCTTTGTCATCCTATGCCT4018322.6110031438054984No Hit
TACCCTGTAGAACCGAATTTGT4014852.608748425189509No Hit
TCCTTCATTCCACCGGAGTCTG3011661.9569008262341643No Hit
AACAGTAAGAGTTTATGTGCTG2839401.8449706162081No Hit
AAGCTGCCAGCTGAAGAACTGT2830971.8394930144983606No Hit
CCTGTCTGAGGGTCGCT1984931.2897575280798563No Hit
TGAGGTAGTAGGTTGTATAGTT1905551.2381784030835195No Hit
TAGCTTATCAGACTGGTGTTGGC1887681.2265669270985793No Hit
TACCCTGTAGAACCGAATTTGC1733621.12646261874716No Hit
TACCCTGTAGAACCGAATTTGCG1555951.0110171269595665No Hit
AACATTCAACGCTGTCGGTGA1548791.006364739267783No Hit
TATTGCACTTGTCCCGGCCTGT1468980.9545062111000122No Hit
TCCTTCATTCCACCGGAGTCTGT1238400.8046811337297004No Hit
ACAGTAGTCTGCACATTGGTT1176850.764687493725612No Hit
TTCACGTAATCCAGGATAGGCT1074140.6979491222419415No Hit
CCTTTCTGAGGGTCGCT912900.593179430702393No Hit
AACTCCAGTCACGCCAATATCT811800.5274871966745565Illumina PCR Primer Index 6 (100% over 22bp)
TTCACAGTGGTTAAGTTCTG801690.5209179732717728No Hit
CTACGCCTGTCTGAGGGTCGCT790220.5134650561174772No Hit
CTGTCTGAGGGTCGCT767480.49868917677234365No Hit
TTCACAGTGGCTAAGTTCTG754710.4903915523555734No Hit
ACCCTGTAGAACCGAATTTGCG748770.48653188994088153No Hit
TTGGTCCCCTTCAACCAGCTGT737890.479462339928786No Hit
TTAGGTAGTAGGTTGTATAGTT684660.4448748264045354No Hit
TTCAAGTAATCCAGGATAGGTT642430.41743483587045493No Hit
TTCACAGTGGCTAAGTTCTGC640360.4160898019986684No Hit
GTGTAATGGTTAGCACTCTG637060.41394554510161735No Hit
TTCACAGTGGCTAAGTTCAGT631480.41031980162114917No Hit
AACTCCAGTCACGCCAATATCTCG591730.38449125263394346Illumina PCR Primer Index 6 (100% over 24bp)
TGATGTAGTAGGTTGTATAGTT590160.383471106170801No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT557880.36249637506873805No Hit
CCACGTTCCCGTGG551290.35821435902280885No Hit
AAGCTGCCAGCTGAAGAACT540790.35139172344128283No Hit
ACATTAGTCTGCACATTGGTT538970.3502091332738183No Hit
TACAGTAGTCTGCACATTGGTT515570.33500440254927455No Hit
TAGCTTATCAGACTGGTGTTGG473190.3074669457926008No Hit
TCCTTCATTCCACCGGAGTCT471680.30648578581849567No Hit
AACTCCAGTCACGCCAATATCTC462980.30083274490808837Illumina PCR Primer Index 6 (100% over 23bp)
TTTGGTCCCCTTCAACCAGCTGT460140.2989873844269899No Hit
TACCATGTAGAACCGAATTTGT436840.283847631184175No Hit
TGTCTGAGGGTCGCT433690.28180084050971715No Hit
TTCCATTTGTCATCCTATGCCT423410.27512115538799453No Hit
TTCAAGTAATCCAGGATAGGC419330.27247007413345864No Hit
AAGCTGCCAGCTGAAGAACTGC417500.2712809862178213No Hit
TACCCTGTAGATCCGGATTTGT410280.26658961203700055No Hit
AACTCCAGTCACGCCAATATCTCGTATGC407020.264471346132641Illumina PCR Primer Index 6 (100% over 29bp)
TTCCCTTTGTCATCCTATGCCTG406360.26404249475323077No Hit
TTATGTAGTAGGTTGTATAGTT390060.2534511652314332No Hit
TTCAGTCATTGTTTCTGGTTGT382570.24858435184994462No Hit
TGAGGTAGTAGTTTGTATAGTT380750.2474017616824801No Hit
TAACGGAACCCATAATGCAGCTG354930.23062457590009894No Hit
ACAGTAGTCTGCACATTGGTTA341860.22213201903814223No Hit
TTGTTCCCCTTCAACCAGCTGT329650.21419826851905338No Hit
ACCCTGTAGAACCGAATTTGTG322810.20975380876880212No Hit
CATTGCACTTGTCTCGGTCTGA321460.20887661276546304No Hit
TTCACAGTGGTTAAGTTCTGCC318490.20694678155811713No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG316290.2055172769600831No Hit
AACATTCATTGCTGTCGGTGGG310190.2015536505746251No Hit
TATGTGCCCTTGGACTACATCG294210.19117024899435975No Hit
TTCAAGTAATCCAGGATAGGCTT276800.1798576694253723No Hit
AACATTCATTGCTGTCGGTGGGT274350.1782657211230162No Hit
ATGACCTATGAATTGACAGCC272330.17695317599209406No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC266000.1728401013986598No Hit
CACCACGTTCCCGTGG261670.1700265764398019No Hit
TTCACAGTGGTTAAGTTCTGC258390.16789531503909663No Hit
AACCCGTAGATCCGAACTTGTG257130.1670765987693135No Hit
TATTGCACTTGTCCCGGCCTGTT253550.16475040492342174No Hit
TACCCTGTAGAACCGAATTTG252710.16420459407689966No Hit
TGAGGTAGTAGGTTGTATAGT236390.15360026905875634No Hit
ATGACCTATGAATTGACAGCCA235200.1528270370261834No Hit
AACATTAAGAGTTTATGTGCTG233160.15150149639891547No Hit
TACCCTGTAGAACCGAATGTGT227170.14760934524335917No Hit
TCCAGCATCAGTGATTTTGTTG223770.14540011086457932No Hit
TTTCTGAGGGTCGCT211420.13737539187107012No Hit
AACACTCAACGCTGTCGGTGAG208320.13536108993747673No Hit
GAAGGATCATTA207200.13463334214211395No Hit
TCCCTGAGACCCTTAACCTGTG203370.13214470459190017No Hit
TTCAGGTAATCCAGGATAGGCT196570.12772623583434042No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC191580.12448385949607234No Hit
TACCATGTAGAACCGAATTTGC185040.12023433219100754No Hit
TACAGTACTGTGATAACTGAAG181060.11764822841820054No Hit
TTTGGTCCCCTTCAACCAGCTG176410.11462677551781042No Hit
ACCACGTTCCCGTGG175210.11384704573706458No Hit
AACATTCAACGCTGTCGGTGG174160.11316478217891197No Hit
GCATTGGTGGTTCAGTGGTAGAATTC174120.11313879118622046No Hit
TCCAGCATCAGTGATTTTGTT173660.1128398947702679No Hit
TGAGGTAGTAGGTTGTATAGTTT170950.11107900501541687No Hit
TTTTGTCCCCTTCAACCAGCTGT168940.1097729576326676No Hit
CATTATTACTTTTGGTACGCG168940.1097729576326676No Hit
TACATTCAACGCTGTCGGTGAG167500.1088372818957726No Hit
CACGTTCCCGTGG166830.10840193276818952No Hit
TACCATGTAGAACCGAATTTGCG166420.10813552509310136No Hit
GAGAGAGGCATGATCGTAGCGATA166080.10791460165522337No Hit
AACTCCAGTCACGCCAATATCTCGT164510.1068944551920809Illumina PCR Primer Index 6 (100% over 25bp)
AACACTCAACGCTGTCGGTGAGT163050.10594578395884013No Hit
TTCCAGTGATGACAGCCTATAATCTGACT159300.10350912839400943No Hit
ACCCTGTAGAACCGAATTTGT155280.10089703362851088No Hit
ACATTAGTCTGCACATTGGTTA154830.10060463496073119No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC46350.0721.29523
GATTCCT79600.0651.933823
ATTCGGC24700.0542.913223
CGCATTG1500.0470.5247823
AGCGCCT3100.0467.3293823
TAACTGC3750.0465.571923
AATAACC1600.0441.1169423
AGTATTT1050.0424.5336323
TCGTATG49000.0397.6986722
CATAGCT6300.0395.0521223
ATAACTA8500.0381.6974522
ACAACCC7600.0380.673822
GGATTCC108300.0371.1331222
TTCTCGC29700.0362.7118223
AATGCTC10500.0360.1640322
TAACTAA1000.0334.3202523
ATTCCTG8800.0325.0335723
GCTTCCT1600.0325.0335423
TCACGTT23150.0302.6127622
GCCCACA258.2781946E-4297.1735523