FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_7_JG53_5_CAGATC_L002_R1_001_TRIMMED_prinseq_good_tAdv.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_7_JG53_5_CAGATC_L002_R1_001_TRIMMED_prinseq_good_tAdv.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15865845
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG8960765.647830292051889No Hit
AACATTCAACGCTGTCGGTGAGT7417574.675181183227241No Hit
TTCAAGTAATCCAGGATAGGCT6851834.318603894088213No Hit
TACCCTGTAGAACCGAATTTGT4316332.7205169343328386No Hit
TTCCCTTTGTCATCCTATGCCT4173222.6303168851076006No Hit
TAGCTTATCAGACTGGTGTTGGC3449532.1741861211930407No Hit
CCTGTCTGAGGGTCGCT3004931.8939615255285802No Hit
AAGCTGCCAGCTGAAGAACTGT2802661.7664738310502845No Hit
TCCTTCATTCCACCGGAGTCTG2673701.6851923109043356No Hit
AACAGTAAGAGTTTATGTGCTG2405971.5164461773072913No Hit
TATTGCACTTGTCCCGGCCTGT2122331.3376722134875263No Hit
TGAGGTAGTAGGTTGTATAGTT2101411.3244866567144706No Hit
TACCCTGTAGAACCGAATTTGCG2027061.277624986251914No Hit
TACCCTGTAGAACCGAATTTGC1889591.19097974296358No Hit
AACATTCAACGCTGTCGGTGA1516050.9555431809651488No Hit
CCTTTCTGAGGGTCGCT1347550.8493402021764361No Hit
CTACGCCTGTCTGAGGGTCGCT1254080.7904274874738786No Hit
ACAGTAGTCTGCACATTGGTT1219730.7687772066347554No Hit
TTCACGTAATCCAGGATAGGCT1103780.6956956909638282No Hit
ATGACCTATGAATTGACAGCC1017110.6410689124972544No Hit
TTGGTCCCCTTCAACCAGCTGT957800.6036867245331087No Hit
TCCTTCATTCCACCGGAGTCTGT918530.5789354427703031No Hit
ACCCTGTAGAACCGAATTTGCG917690.578406003588211No Hit
ATGACCTATGAATTGACAGCCA889150.5604176770918914No Hit
CTGTCTGAGGGTCGCT865610.5455807742985009No Hit
TTTGGTCCCCTTCAACCAGCTGT768760.48453769717276324No Hit
TTCACAGTGGCTAAGTTCTG743370.468534767609289No Hit
TACCCTGTAGATCCGGATTTGT714700.45046450409669325No Hit
TAACGGAACCCATAATGCAGCTG669010.42166679429932663No Hit
TTCACAGTGGTTAAGTTCTG622530.3923711595568973No Hit
TTCACAGTGGCTAAGTTCTGC613890.3869254993982356No Hit
TTAGGTAGTAGGTTGTATAGTT594680.3748177295315818No Hit
TACAGTAGTCTGCACATTGGTT565180.35622432968429985No Hit
TTCAAGTAATCCAGGATAGGTT561650.3539994245500318No Hit
TTATGTAGTAGGTTGTATAGTT555110.3498773623466005No Hit
TTCACAGTGGCTAAGTTCAGT539500.3400386175460557No Hit
TGTCTGAGGGTCGCT534330.33678004543722695No Hit
CCACGTTCCCGTGG529960.3340257011208669No Hit
TGATGTAGTAGGTTGTATAGTT515100.32465966987576145No Hit
TAGCTTATCAGACTGGTGTTGG509280.3209914126855519No Hit
AAGCTGCCAGCTGAAGAACT496150.31271577404165996No Hit
TTCCCTTTGTCATCCTATGCCTG489570.3085685004486052No Hit
ACATTAGTCTGCACATTGGTT489120.3082848723153415No Hit
AACTCCAGTCACCAGATCATCT488690.3080138498768896Illumina PCR Primer Index 7 (100% over 22bp)
AAGCTGCCAGCTGAAGAACTGC487870.30749701638960925No Hit
AACATTCATTGCTGTCGGTGGG421340.26556417259843396No Hit
TGAGGTAGTAGTTTGTATAGTT419670.2645115970816556No Hit
TACCATGTAGAACCGAATTTGT417420.2630934564153375No Hit
TATGTGCCCTTGGACTACATCG405530.25559937084977197No Hit
ACCCTGTAGAACCGAATTTGTG398200.2509793837012778No Hit
TTCCATTTGTCATCCTATGCCT398050.25088484099018993No Hit
CATTGCACTTGTCTCGGTCTGA397320.25042473312956226No Hit
ACAGTAGTCTGCACATTGGTTA393800.24820613084270016No Hit
TTGTTCCCCTTCAACCAGCTGT367720.23176830480822166No Hit
TTCAAGTAATCCAGGATAGGC352770.22234554793646352No Hit
AACATTCATTGCTGTCGGTGGGT349840.22049881364654703No Hit
AACTCCAGTCACCAGATCATCTCGTATGC330410.20825238113696434Illumina PCR Primer Index 7 (100% over 29bp)
AACTCCAGTCACCAGATCATCTCG324210.2043446157453322Illumina PCR Primer Index 7 (100% over 24bp)
TCCAGCATCAGTGATTTTGTTG323150.2036765139203112No Hit
TATTGCACTTGTCCCGGCCTGTT319010.2010671350942859No Hit
TACCCTGTAGATCCGGATTTGTG295400.1861861123690544No Hit
AACCCGTAGATCCGAACTTGTG291530.18374691042298724No Hit
TTTTGTCCCCTTCAACCAGCTGT286300.18045052122972335No Hit
TACCCTGTAGAACCGAATGTGT283440.1786479068716479No Hit
CACCACGTTCCCGTGG276460.17424851938235877No Hit
TCCTTCATTCCACCGGAGTCT272730.1718975572999736No Hit
TTCACAGTGGTTAAGTTCTGCC268630.16931338986357172No Hit
TTTCTGAGGGTCGCT255990.16134659074256683No Hit
AACTCCAGTCACCAGATCATCTC248010.1563169185126919Illumina PCR Primer Index 7 (100% over 23bp)
CATTATTACTTTTGGTACGCG243340.15337348877415605No Hit
TCCCTGAGACCCTTAACCTGTG233810.1473668751963731No Hit
AACACTCAACGCTGTCGGTGAG231920.14617563703666586No Hit
CCCAGTGTTCAGACTACCTGTTC231240.1457470434130675No Hit
TACCCTGTAGAACCGAATTTG229950.1449339760977118No Hit
TTCAAGTAATCCAGGATAGGCTT228040.14373013224319284No Hit
TTTGGTCCCCTTCAACCAGCTG226650.14285403645377853No Hit
TGAGATGAAGCACTGTAGCTC224770.14166910114147718No Hit
TCCAGCATCAGTGATTTTGTT223200.1406795540987574No Hit
TGAGGTAGTAGGTTGTATAGT220930.13924880773762757No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT211740.1334564909716438No Hit
TCCCTGAGACCCTTAACCTGTGA201830.12721036919243822No Hit
TACCCTGTAGAACCGAATTTGTG198500.12511152100628742No Hit
ACCACGTTCCCGTGG198370.12502958399001127No Hit
AACACTCAACGCTGTCGGTGAGT190680.1201826943349062No Hit
TTCACAGTGGTTAAGTTCTGC189850.11965955800021996No Hit
AAGTTCTGTGATACACTTTGACT189070.11916793590256301No Hit
TACCATGTAGAACCGAATTTGCG188940.11908599888628686No Hit
TTCCAGTGATGACAGCCTATAATCTGACT188380.11873303943155879No Hit
CCCAGTGTTCAGACTACCTGTT186590.11760482974591017No Hit
TACGCCTGTCTGAGGGTCGCT185490.11691151653126575No Hit
GTGTAATGGTTAGCACTCTG182620.11510259932578443No Hit
TACCATGTAGAACCGAATTTGC180350.11367185296465457No Hit
AACATTCAACGCTGTCGGTGG178910.11276424293821098No Hit
TCCCTGAGACCCTAACTTGTGA175220.11043849224544927No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG173060.10907707720578387No Hit
TGTAAACATCCTTGACTGGAAGCT170160.10724925145808498No Hit
CCCAGTGTTCAGACTACCTGTTCT169190.10663787525971671No Hit
TATTTGCCCTTGGACTACATCG168850.10642357844791751No Hit
TTCAGTCATTGTTTCTGGTTGT162510.10242757319260334No Hit
TATTGCACTTGTCCCGGCCTGTA160910.10141911760766602No Hit
TGAGGTAGTAGGTTGTATAGTTT159140.1003035136168291No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC38200.0758.693923
GATTCCT30650.0684.20223
CGCACTG16350.0634.102923
GACGTTC5250.0590.937223
GATATCC204.569356E-7589.067223
TATCTCC24650.0540.077823
CACTTCA2550.0539.0157523
ATACATT1600.0515.433823
CAACCCG7750.0476.3209823
GATATCT2300.0461.0091223
AATAACC1800.0458.1633623
TGGCTTT6750.0447.9819323
ACCCTAC1950.0443.059123
CACACTC3450.0421.1688223
ATTCGGC11550.0397.8116523
ACAACCC11700.0381.3512622
ATAACTA8700.0371.6998622
TCGTATG43500.0360.4076522
GGATTCC44700.0360.3476622
TAACTAA1550.0354.7071223