FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_7_JG55_5_ACTTGA_L003_R1_001_TRIMMED_prinseq_good_9JRe.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_7_JG55_5_ACTTGA_L003_R1_001_TRIMMED_prinseq_good_9JRe.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences26255677
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG7625482.9043166550228356No Hit
TTCAAGTAATCCAGGATAGGCT7578972.8866023907896188No Hit
AACATTCAACGCTGTCGGTGAGT6713512.556974630667493No Hit
TAGCTTATCAGACTGGTGTTGGC5853802.2295368731112895No Hit
TACCCTGTAGAACCGAATTTGT4164241.5860341365412134No Hit
CCTGTCTGAGGGTCGCT4120931.569538656344683No Hit
TGAGGTAGTAGGTTGTATAGTT3083661.1744736195528305No Hit
TCCTTCATTCCACCGGAGTCTG3082801.1741460713429708No Hit
TTCCCTTTGTCATCCTATGCCT2904291.1061569655964307No Hit
AAGCTGCCAGCTGAAGAACTGT2789251.0623416794775469No Hit
AACAGTAAGAGTTTATGTGCTG2496730.9509295837239313No Hit
TATTGCACTTGTCCCGGCCTGT2426760.9242801090217556No Hit
TACCCTGTAGAACCGAATTTGCG2249010.8565804644839285No Hit
ATGACCTATGAATTGACAGCC2030120.7732118276744493No Hit
TACCCTGTAGAACCGAATTTGC1978750.7536465351855144No Hit
ATGACCTATGAATTGACAGCCA1850700.7048761302174764No Hit
TTGGTCCCCTTCAACCAGCTGT1736020.6611979573027197No Hit
TAACGGAACCCATAATGCAGCTG1649720.6283288753133275No Hit
ACAGTAGTCTGCACATTGGTT1464920.5579440971946753No Hit
TTTGGTCCCCTTCAACCAGCTGT1403730.5346386611931584No Hit
AACATTCAACGCTGTCGGTGA1401420.5337588514666752No Hit
CTACGCCTGTCTGAGGGTCGCT1301900.4958546679257213No Hit
TCCTTCATTCCACCGGAGTCTGT1176670.44815831639001347No Hit
TGAGATGAAGCACTGTAGCTC1099960.4189417778105665No Hit
CTGTCTGAGGGTCGCT1042440.39703413475112453No Hit
TGAGATGAAGCACTGTAGCTCT974860.371294939376349No Hit
TGTCTGAGGGTCGCT964120.3672043954532195No Hit
ACCCTGTAGAACCGAATTTGCG959030.36526576709486486No Hit
TTCACGTAATCCAGGATAGGCT852400.32465359777239794No Hit
TTCACAGTGGTTAAGTTCTG836440.3185749123894235No Hit
TTCACAGTGGCTAAGTTCTG807200.3074382732541995No Hit
AACTCCAGTCACACTTGAATCT800270.30479884407475Illumina PCR Primer Index 8 (100% over 22bp)
TGAGGTAGTAGTTTGTATAGTT723940.2757270360996595No Hit
TTCACAGTGGCTAAGTTCTGC717200.2731599722223883No Hit
TTCAAGTAATCCAGGATAGGTT679740.2588925815929256No Hit
CCTTTCTGAGGGTCGCT662200.2522121215918371No Hit
TAGCTTATCAGACTGGTGTTGG638660.24324644152196115No Hit
CCACGTTCCCGTGG597060.2274022490450351No Hit
AAGCTGCCAGCTGAAGAACT568230.2164217666145116No Hit
AAGCTGCCAGCTGAAGAACTGC549950.2094594628049393No Hit
TACAGTAGTCTGCACATTGGTT500370.190575927636526No Hit
TTCACAGTGGCTAAGTTCAGT495630.18877060378218394No Hit
TTCCCTTTGTCATCCTATGCCTG473460.18032671562801447No Hit
CATTGCACTTGTCTCGGTCTGA469620.17886417478399053No Hit
TACCCTGTAGATCCGGATTTGT469030.17863946147722642No Hit
TGTAAACATCCTTGACTGGAAGCT468760.178536626574131No Hit
AACTCCAGTCACACTTGAATCTCG462070.17598860619743303Illumina PCR Primer Index 8 (100% over 24bp)
ACAGTAGTCTGCACATTGGTTA457100.17409568224045413No Hit
AACTCCAGTCACACTTGAATCTC449870.1713419920575653Illumina PCR Primer Index 8 (100% over 23bp)
AACTCCAGTCACACTTGAATCTCGTATGC435820.16599076839648813Illumina PCR Primer Index 8 (100% over 29bp)
TATGTGCCCTTGGACTACATCG433400.16506906296874388No Hit
TGAGATGAAGCACTGTAGCT427260.16273052109835143No Hit
TGATGTAGTAGGTTGTATAGTT425900.1622125378827596No Hit
CACCACGTTCCCGTGG425490.16205638117805912No Hit
TTCACAGTGGTTAAGTTCTGCC420390.16011394411958982No Hit
TTCAAGTAATCCAGGATAGGC411970.15690701862305817No Hit
AACATTCATTGCTGTCGGTGGG387810.1477051991460742No Hit
TATTGCACTTGTCCCGGCCTGTT384290.14636453670571892No Hit
ACCCTGTAGAACCGAATTTGTG370730.14119993935025937No Hit
AACATTCATTGCTGTCGGTGGGT359660.1369837083233466No Hit
TTTGGTCCCCTTCAACCAGCTG355460.1353840542751954No Hit
TGAGGTAGTAGGTTGTATAGT351740.13396721783254723No Hit
TGAGAACTGAATTCCATAGATGG350610.13353683471959227No Hit
TTCAGTCATTGTTTCTGGTTGT350350.1334378085166115No Hit
TCCTTCATTCCACCGGAGTCT347000.13216189397820519No Hit
TGTAAACATCCTACACTCTCAGCT313110.11925420928967097No Hit
CACGTTCCCGTGG309260.11778785974553238No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT303950.11576543998465551No Hit
AACCCGTAGATCCGAACTTGTG298460.11367446362171502No Hit
TTCACAGTGGTTAAGTTCTGC295100.1123947403831941No Hit
TACCATGTAGAACCGAATTTGT290210.11053228602713236No Hit
TGAGGTAGTAGATTGAATAGTT286590.1091535365856306No Hit
TTCAAGTAATCCAGGATAGGCTT286190.10900118858104477No Hit
TGTAAACATCCCCGACTGGAAGCT271740.10349761691538176No Hit
TCCAGCATCAGTGATTTTGTTG263420.10032877841999657No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC53400.0273.9926523
GATTCCT53450.0205.587423
TCGTATG56700.0108.0571322
TTACGCC3200.0104.78078523
GGATTCC66200.094.32307422
ACACGCC18100.085.0455823
ATAACTA13500.077.7749822
ACGAAGT5400.073.3818323
TCTGACT113500.072.2429323
CAACCCG13600.064.997723
TATCTCC12650.062.65009723
CTCGTAT79400.062.12700721
TACCCGC7050.061.32445522
CCGCCCA6750.060.96336423
TTCTCGC27050.058.03351623
ATATGCC9850.054.5516422
ATTCGGC21950.054.15879423
TCTCGTA81700.053.74691420
ACAACCC23150.053.09172422
TTGCCGC6750.053.06998422