FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_7_JG64_5_GATCAG_L004_R1_001_TRIMMED_prinseq_good_kqBb.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_7_JG64_5_GATCAG_L004_R1_001_TRIMMED_prinseq_good_kqBb.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14433654
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAG7258705.029010671864518No Hit
TTCAAGTAATCCAGGATAGGCT7031804.871808621711453No Hit
AACATTCAACGCTGTCGGTGAGT6406894.4388551921779476No Hit
TCCTTCATTCCACCGGAGTCTG4099392.840160918364816No Hit
TACCCTGTAGAACCGAATTTGT4034452.7951688463641986No Hit
TTCCCTTTGTCATCCTATGCCT3241342.2456822090927218No Hit
TAGCTTATCAGACTGGTGTTGGC2849171.9739769291961689No Hit
AAGCTGCCAGCTGAAGAACTGT2786411.9304952162494682No Hit
CCTGTCTGAGGGTCGCT2721621.885607068036964No Hit
TGAGGTAGTAGGTTGTATAGTT2532601.754649238508835No Hit
AACAGTAAGAGTTTATGTGCTG2375671.6459241713844601No Hit
ACAGTAGTCTGCACATTGGTT1775981.2304437947591096No Hit
TACCCTGTAGAACCGAATTTGCG1598761.1076613032292448No Hit
AACATTCAACGCTGTCGGTGA1559981.0807935398756268No Hit
TACCCTGTAGAACCGAATTTGC1556311.0782508711931158No Hit
TATTGCACTTGTCCCGGCCTGT1427550.9890426914764618No Hit
TCCTTCATTCCACCGGAGTCTGT1412030.978290043532982No Hit
TTCACAGTGGTTAAGTTCTG1046510.7250485566579329No Hit
TTCACAGTGGCTAAGTTCTG908730.6295910931493854No Hit
CTACGCCTGTCTGAGGGTCGCT764000.529318494124911No Hit
CTGTCTGAGGGTCGCT741770.5139169887264861No Hit
TTGGTCCCCTTCAACCAGCTGT715690.49584810609981367No Hit
TTCACAGTGGCTAAGTTCTGC705500.4887882167606346No Hit
ACCCTGTAGAACCGAATTTGCG671710.46537765142492676No Hit
TTCAAGTAATCCAGGATAGGTT648020.44896462115553No Hit
TTCACAGTGGCTAAGTTCAGT589630.4085105545692034No Hit
TGAGGTAGTAGTTTGTATAGTT546030.37830337349087073No Hit
ACAGTAGTCTGCACATTGGTTA543650.376654449386136No Hit
AAGCTGCCAGCTGAAGAACT536960.3720194484362726No Hit
TTCCCTTTGTCATCCTATGCCTG492320.3410917290936862No Hit
AACTCCAGTCACGATCAGATCT476980.33046378969594253Illumina PCR Primer Index 9 (100% over 22bp)
TACAGTAGTCTGCACATTGGTT473400.3279834752862997No Hit
TAACGGAACCCATAATGCAGCTG472510.32736686081015937No Hit
TTAGGTAGTAGGTTGTATAGTT472210.3271590132339323No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT471320.32654239875779206No Hit
TAGCTTATCAGACTGGTGTTGG461950.3200506261269669No Hit
TTTGGTCCCCTTCAACCAGCTGT450860.31236719405910657No Hit
TGTCTGAGGGTCGCT434850.3012750617411225No Hit
CCACGTTCCCGTGG432480.29963306588892874No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG427400.2961135135981505No Hit
AAGCTGCCAGCTGAAGAACTGC427370.29609272884052784No Hit
TTCAAGTAATCCAGGATAGGC416720.28871413988446726No Hit
TACCCTGTAGATCCGGATTTGT415550.2879035343371817No Hit
TATGTGCCCTTGGACTACATCG413530.2865040273239195No Hit
TCCTTCATTCCACCGGAGTCT412510.2857973455647475No Hit
TTCACAGTGGTTAAGTTCTGCC405650.28104456432168873No Hit
CACCACGTTCCCGTGG393760.2728068720505563No Hit
AACTCCAGTCACGATCAGATCTCGTATGC393330.2725089571912975Illumina PCR Primer Index 9 (100% over 29bp)
GTGTAATGGTTAGCACTCTG390110.2702780598731271No Hit
TTCAGTCATTGTTTCTGGTTGT349070.24184451144526534No Hit
AACATTCATTGCTGTCGGTGGGT345900.23964825538979945No Hit
AACATTCATTGCTGTCGGTGGG337520.23384237976052358No Hit
AACATTAAGAGTTTATGTGCTG330160.22874318589041973No Hit
TTCACAGTGGTTAAGTTCTGC328460.2275653829584664No Hit
ACCCTGTAGAACCGAATTTGTG320940.2223553370477081No Hit
TGAGGTAGTAGGTTGTATAGT306390.2122747296006957No Hit
AACTCCAGTCACGATCAGATCTCG293150.20310172323654152Illumina PCR Primer Index 9 (100% over 24bp)
AACCCGTAGATCCGAACTTGTG292210.2024504674976967No Hit
TTCAAGTAATCCAGGATAGGCTT279700.19378322356902833No Hit
CATTGCACTTGTCTCGGTCTGA277870.19251535335404327No Hit
AACTCCAGTCACGATCAGATCTC274870.1904368775917727Illumina PCR Primer Index 9 (100% over 23bp)
TGAGATGAAGCACTGTAGCTC253450.17559656064916065No Hit
TACCCTGTAGAACCGAATTTG250600.17362200867500358No Hit
TGAGGTAGTAGATTGAATAGTT244830.16962440695890313No Hit
ACCACGTTCCCGTGG226880.1571881936479841No Hit
TATTGCACTTGTCCCGGCCTGTT226760.15710505461749324No Hit
TACCCTGTAGAACCGAATGTGT226030.1565992921820074No Hit
GCGTGTCGTTGGCATT223620.15492958331965004No Hit
CACGTTCCCGTGG219680.15219985181853465No Hit
TTCACGTAATCCAGGATAGGCT218440.15134074850346282No Hit
TGAGGTAGTAGGTTGTATAGTTT216040.14967796789364635No Hit
TCCAGCATCAGTGATTTTGTTG208260.1442877874168246No Hit
TCCCTGAGACCCTTAACCTGTG207050.14344946885937546No Hit
TGTAAACATCCTTGACTGGAAGCT202710.140442607256624No Hit
AACATTCAACGCTGTCGGTGG198310.13739417613862714No Hit
TTCCAGTGATGACAGCCTATAATCTGACT197700.13697155273363212No Hit
GCGTGTCGTTGGCAT196930.13643807728798266No Hit
TGAGATGAAGCACTGTAGCTCT195630.13553740445766538No Hit
TACGCCTGTCTGAGGGTCGCT195050.1351355658102931No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTC194210.1345535925968573No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC188900.13087469049763836No Hit
CCTTTCTGAGGGTCGCT188220.13040356932485703No Hit
ATGACCTATGAATTGACAGCC182810.12665538470022908No Hit
TGAGGTAGTAGTTTGTGCTGTT180940.12535980147508038No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCG179700.12450069816000854No Hit
TCCCTGAGACCCTTAACCTGTGA174060.12059316372693982No Hit
TACCCTGTAGAACCGAATTTGTG171370.1187294637934372No Hit
AACATTCAACGCTGTCGGTGAGA167860.1162976471515806No Hit
CAGTAGTCTGCACATTGGTT165200.11445473197570068No Hit
TACCCTGTAGATCCGGATTTGTG163620.11336006807423818No Hit
TCCTCGGTAGTATAGTGGTGAGTATCTCC162940.11288894690145684No Hit
GCATTGTTGGTTCAGTGGTAGAATGC162070.11228618893039835No Hit
TGGACGGAGAACTGATAAGGGC161500.11189127853556695No Hit
TTCACAGTGGCTAAGTTCTGCT160260.11103217522049509No Hit
AAGTTCTGTGATACACTTTGACT158260.1096465247123147No Hit
TGAGTTAGTAGGTTGTATAGTT155360.10763733147545312No Hit
TCCAGCATCAGTGATTTTGTT152980.10598840737071845No Hit
TCACAGTGAACCGGTCTCTTT152370.10556578396572344No Hit
TGAGGTAGTTGGTTGTATAGTT151970.10528865386408737No Hit
CATTATTACTTTTGGTACGCG151710.10510851929802392No Hit
ATGACCTATGAATTGACAGCCA150220.10407620966942951No Hit
CCCAGTGTTCAGACTACCTGTTC146430.10145040195642767No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC44000.0679.65323
GATTCCT57450.0611.169323
GATATCC2650.0610.707123
GCGCACG252.4556357E-9562.912623
GATATCT5600.0527.730623
CGCACTG5200.0527.730623
TATCTCC26550.0527.399323
CAACCCG1200.0498.4122623
AATAACC650.0487.135923
TATCCCC3600.0478.8666423
ACCCTAC2100.0469.0938723
ATTCGGC17650.0460.4561523
GACGTTC2550.0427.7032223
CATATTG10400.0412.7123723
CATAGCT4550.0402.0804423
AGCATGG2850.0395.026423
TAACTGC2950.0369.7095623
ATACATT1350.0364.850823
CGCATTG2200.0351.820423
CCCTACG204.9927714E-4351.8203723