FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_grz_7_JG65_5_TAGCTT_L005_R1_001_TRIMMED_prinseq_good_bNDV.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_grz_7_JG65_5_TAGCTT_L005_R1_001_TRIMMED_prinseq_good_bNDV.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20617501
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT11064305.366460270815556No Hit
AACATTCAACGCTGTCGGTGAG8712254.225657610008119No Hit
AACATTCAACGCTGTCGGTGAGT6657633.2291158855770155No Hit
TGAGGTAGTAGGTTGTATAGTT5832982.829140156219709No Hit
TTCCCTTTGTCATCCTATGCCT5631322.7313300481954625No Hit
TACCCTGTAGAACCGAATTTGT5574512.703775787375977No Hit
TCCTTCATTCCACCGGAGTCTG4649352.2550502119534275No Hit
AACAGTAAGAGTTTATGTGCTG3897931.8905928511898702No Hit
CCTGTCTGAGGGTCGCT3706741.7978609531775942No Hit
AAGCTGCCAGCTGAAGAACTGT3524051.7092517662543099No Hit
TAGCTTATCAGACTGGTGTTGGC3018121.4638631519891765No Hit
TACCCTGTAGAACCGAATTTGC2594541.258416332803864No Hit
TTGGTCCCCTTCAACCAGCTGT2257211.0948029055509685No Hit
TATTGCACTTGTCCCGGCCTGT2187501.0609918243728957No Hit
TACCCTGTAGAACCGAATTTGCG2141121.0384963725720202No Hit
ACAGTAGTCTGCACATTGGTT2103631.0203127915453964No Hit
TCCTTCATTCCACCGGAGTCTGT1909960.9263780319448026No Hit
AACATTCAACGCTGTCGGTGA1845440.8950842296551846No Hit
TTTGGTCCCCTTCAACCAGCTGT1460900.7085727799891947No Hit
GTGTAATGGTTAGCACTCTG1425610.6914562535973685No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT1402640.6803152331604106No Hit
ATGACCTATGAATTGACAGCC1314620.6376233472718154No Hit
TTCACAGTGGTTAAGTTCTG1296000.6285921848627533No Hit
TTCACAGTGGCTAAGTTCTG1208890.5863416715730971No Hit
TGAGGTAGTAGTTTGTATAGTT1158940.5621146811148451No Hit
CTACGCCTGTCTGAGGGTCGCT1155790.5605868528877481No Hit
ATGACCTATGAATTGACAGCCA1085360.5264265538291959No Hit
CTGTCTGAGGGTCGCT995390.48278886951430244No Hit
TTCAAGTAATCCAGGATAGGTT994340.48227959343860344No Hit
CCACGTTCCCGTGG982690.47662905412251466No Hit
TTCACAGTGGCTAAGTTCTGC915600.44408873800951915No Hit
ACCCTGTAGAACCGAATTTGCG904610.4387583150838698No Hit
TGTCTGAGGGTCGCT819540.3974972524555716No Hit
TTCACAGTGGCTAAGTTCAGT819490.39747300121387164No Hit
TGAGGTAGTAGGTTGTATAGT778000.37734932085125156No Hit
AACTCCAGTCACTAGCTTATCT741150.35947615571838704Illumina PCR Primer Index 10 (100% over 22bp)
TAACGGAACCCATAATGCAGCTG690660.33498725184977557No Hit
TAGCTTATCAGACTGGTGTTGG638130.30950889731980613No Hit
TCCTTCATTCCACCGGAGTCT635310.3081411272879288No Hit
AAGCTGCCAGCTGAAGAACT632250.30665695129589177No Hit
TGAGGTAGTAGGTTGTATAGTTT623990.3026506461670597No Hit
TTCAAGTAATCCAGGATAGGC613250.29744147944991006No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTC605860.2938571459266571No Hit
TACAGTAGTCTGCACATTGGTT597900.28999634824802484No Hit
TTCCCTTTGTCATCCTATGCCTG537460.26068144728112297No Hit
CCTTTCTGAGGGTCGCT536510.2602206736888239No Hit
ACAGTAGTCTGCACATTGGTTA532240.258149617647648No Hit
TACCCTGTAGATCCGGATTTGT526470.2553510243554736No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG525000.25463803784949496No Hit
TTTGGTCCCCTTCAACCAGCTG521390.25288709819875843No Hit
AAGCTGCCAGCTGAAGAACTGC521070.25273189025187875No Hit
TATGTGCCCTTGGACTACATCG514860.24971988603274473No Hit
TTCACAGTGGTTAAGTTCTGCC509150.24695039423061022No Hit
AACTCCAGTCACTAGCTTATCTCG507410.2461064510194519Illumina PCR Primer Index 10 (100% over 24bp)
TGAGATGAAGCACTGTAGCTC503910.24440886410045526No Hit
TGAGATGAAGCACTGTAGCTCT490720.23801138654000795No Hit
CATTGCACTTGTCTCGGTCTGA462300.2242269807577553No Hit
TGAGGTAGTAGATTGAATAGTT455550.22095306312826177No Hit
GCATTGGTGGTTCAGTGGTAGAATTC455040.22070570046292226No Hit
TTCAAGTAATCCAGGATAGGCTT450240.21837758125972687No Hit
TTCAGTCATTGTTTCTGGTTGT445830.2162386217417911No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC416180.20185763541371965No Hit
AACTCCAGTCACTAGCTTATCTC406580.19720139700732886Illumina PCR Primer Index 10 (100% over 23bp)
TATTGCACTTGTCCCGGCCTGTT399120.19358311174569603No Hit
CACCACGTTCCCGTGG397220.19266156456109787No Hit
TCCAGCATCAGTGATTTTGTTG394260.19122589105246074No Hit
AACATTCATTGCTGTCGGTGGG391690.18997937722908317No Hit
ACCCTGTAGAACCGAATTTGTG389890.18910633252788495No Hit
TTCACAGTGGTTAAGTTCTGC386110.18727293865536856No Hit
AACTCCAGTCACTAGCTTATCTCGTATGC383040.1857839124149915Illumina PCR Primer Index 10 (100% over 29bp)
TACCCTGTAGAACCGAATTTG359770.1744973845278339No Hit
TTCCAGTGATGACAGCCTATAATCTGACT322540.1564399099580497No Hit
TGATGTAGTAGGTTGTATAGTT320150.15528070060479202No Hit
TCCAGCATCAGTGATTTTGTT317570.1540293365330745No Hit
TGTAAACATCCTTGACTGGAAGCT317310.15390323007623474No Hit
AACATTCATTGCTGTCGGTGGGT316950.15372862113599509No Hit
AACCCGTAGATCCGAACTTGTG310700.1506972159235011No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGC297780.14443069506823353No Hit
TGAGGTAGTTGGTTGTATAGTT297630.14435794134313368No Hit
CATTATTACTTTTGGTACGCG286410.13891596270566448No Hit
TGTAAACATCCTACACTCTCAGCT273750.13277554830723665No Hit
TACAGTACTGTGATAACTGAAG263590.12784769599380644No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCG262130.12713955973616783No Hit
TACCCTGTAGAACCGAATGTGT259030.1256359827507708No Hit
ACCACGTTCCCGTGG256550.1244331211624532No Hit
GAAGGATCATTA255630.1239868983151741No Hit
TACGCCTGTCTGAGGGTCGCT248800.12067417869896066No Hit
TGGACGGAGAACTGATAAGGGC248590.12057232348382085No Hit
TTCAAGTAATCCAGGATGGGCT248260.12041226528860118No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGC244040.11836546048912522No Hit
TAGCAGCACGTAAATATTGGAG242610.1176718749765066No Hit
AACATTCAACGCTGTCGGTGG237710.11529525328991132No Hit
TCCCTGAGACCCTTAACCTGTG236690.11480052795923232No Hit
TTAGGTAGTAGGTTGTATAGTT221930.10764156140940649No Hit
TGAGGTAGTAGTTTGTGCTGTT220850.10711773458868754No Hit
TGAGAACTGAATTCCATAGATGG217550.10551715263649071No Hit
TGAGATGAAGCACTGTAGCT216780.10514368351431146No Hit
TTCACAGTGGTTAAGTTCTGCCT216620.1050660795408716No Hit
TATTGCACTTGTCCCGGCCTGTA209810.10176306042133816No Hit
CACGTTCCCGTGG209620.10167090570287833No Hit
TTCACAGTGGCTAAGTTCTGCT208820.10128288583567911No Hit
TCCAGTGATGACAGCCTATAATCTGACT206910.10035648840274096No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC44500.0440.3492723
GATTCCT167150.0393.337923
ATTCGGC44050.0333.8914823
GCTTCCT8850.0295.2247623
CAACCCG5750.0289.869123
AGCGCCT10850.0282.3236423
TTCTCGC41200.0276.6249423
CATAGCT9700.0222.9141123
TCGTATG47400.0220.0242522
CCCGTTC2750.0212.9505223
ATTCCTG17600.0212.4386323
GGATTCC213700.0203.782322
AATAACC4150.0200.8129323
ATAACTA10700.0200.0729222
CGCATTG4050.0194.6485123
TCACGTT31600.0181.8641722
TCTGACT87150.0174.9682823
ACAACCC13200.0172.5876222
TAACTGC4900.0170.0762623
GGCTTCC11050.0161.6191422