FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_12_JM104_5_CACGAT_L001_R1_001_TRIMMED_prinseq_good_iB62.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_12_JM104_5_CACGAT_L001_R1_001_TRIMMED_prinseq_good_iB62.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14161506
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT7865825.554366887250551No Hit
TTCCCTTTGTCATCCTATGCCT7401725.2266475048628305No Hit
AACATTCAACGCTGTCGGTGAG6342454.478655024402066No Hit
AACATTCAACGCTGTCGGTGAGT6164664.353110467205959No Hit
TCCTTCATTCCACCGGAGTCTG3459002.442536831887795No Hit
AAGCTGCCAGCTGAAGAACTGT3303742.332901599589761No Hit
TACCCTGTAGAACCGAATTTGT2926092.066227984509557No Hit
AACAGTAAGAGTTTATGTGCTG2592991.8310128880360605No Hit
TAGCTTATCAGACTGGTGTTGGC2581871.8231606158271585No Hit
TACCCTGTAGAACCGAATTTGC1784271.2599436811310887No Hit
CCTGTCTGAGGGTCGCT1690871.1939902436930083No Hit
TCCTTCATTCCACCGGAGTCTGT1569081.1079895033762652No Hit
TGAGGTAGTAGGTTGTATAGTT1496721.0568932428514313No Hit
TACCCTGTAGAACCGAATTTGCG1472311.0396563755295518No Hit
AACATTCAACGCTGTCGGTGA1358190.959071725846107No Hit
TATTGCACTTGTCCCGGCCTGT1357080.9582879109043911No Hit
TTCACGTAATCCAGGATAGGCT1309380.9246050525982195No Hit
TTCACAGTGGCTAAGTTCTG960300.6781058455223617No Hit
TTGGTCCCCTTCAACCAGCTGT835160.5897395375887282No Hit
TTCCATTTGTCATCCTATGCCT828940.5853473493567704No Hit
CCTTTCTGAGGGTCGCT796990.5627861895479196No Hit
TAACGGAACCCATAATGCAGCTG792920.5599122014282945No Hit
TTCACAGTGGTTAAGTTCTG787220.555887205781645No Hit
AAGCTGCCAGCTGAAGAACT772150.5452456822035735No Hit
TTCCCTTTGTCATCCTATGCCTG723820.5111179559575091No Hit
TTCACAGTGGCTAAGTTCTGC682040.4816154440071558No Hit
ACCCTGTAGAACCGAATTTGCG670230.47327593548313296No Hit
ACAGTAGTCTGCACATTGGTT649040.4583128376318168No Hit
TTTGGTCCCCTTCAACCAGCTGT584480.4127244658866084No Hit
CTGTCTGAGGGTCGCT578660.40861473348950317No Hit
TTCAAGTAATCCAGGATAGGTT566950.4003458389241935No Hit
CTACGCCTGTCTGAGGGTCGCT563680.3980367624742736No Hit
TTAGGTAGTAGGTTGTATAGTT562590.3972670703243002No Hit
TTCAAGTAATCCAGGATAGGC528680.3733218769246717No Hit
TTCACAGTGGCTAAGTTCAGT484070.3418209899427363No Hit
TGATGTAGTAGGTTGTATAGTT470340.33212569341142106No Hit
AAGCTGCCAGCTGAAGAACTGC465310.3285738112881497No Hit
TCCTTCATTCCACCGGAGTCT438000.30928913916358897No Hit
TTCAGTCATTGTTTCTGGTTGT388400.27426461564186744No Hit
TTGTTCCCCTTCAACCAGCTGT372580.2630934873734474No Hit
TAGCTTATCAGACTGGTGTTGG368650.2603183587960207No Hit
TTCAAGTAATCCAGGATAGGCTT347490.24537644513231857No Hit
CATTGCACTTGTCTCGGTCTGA339630.23982618797746513No Hit
TACCCTGTAGAACCGAATGTGT336330.23749592733993122No Hit
TACCCTGTAGATCCGGATTTGT331340.23397229080014512No Hit
TACCATGTAGAACCGAATTTGT328390.23188917901810724No Hit
TTATGTAGTAGGTTGTATAGTT319350.22550567715043865No Hit
ACATTAGTCTGCACATTGGTT298120.2105143337156373No Hit
TATTGCACTTGTCCCGGCCTGTT282380.1993996966141878No Hit
AACATTCATTGCTGTCGGTGGGT281180.19855232910963003No Hit
TGTCTGAGGGTCGCT271050.19139913509198808No Hit
AACATTCATTGCTGTCGGTGGG268970.18993036475075462No Hit
TACAGTAGTCTGCACATTGGTT249660.1762948093232457No Hit
TGAGGTAGTAGTTTGTATAGTT248960.17580051161225366No Hit
TACCCTGTAGAACCGAATTTG245810.1735761719127895No Hit
TTCACAGTGGTTAAGTTCTGCC241020.1701937632904297No Hit
TTCAGGTAATCCAGGATAGGCT238640.16851315107305678No Hit
ATGACCTATGAATTGACAGCC238300.16827306361343206No Hit
AACATTAAGAGTTTATGTGCTG222750.15729259303353754No Hit
TGAGGTAGTAGGTTGTATAGT217770.15377601788962275No Hit
ACCCTGTAGAACCGAATTTGTG216910.15316873784468968No Hit
TTTTGTCCCCTTCAACCAGCTGT215680.15230018615251795No Hit
TTCACAGTGGCTAAGTTCTGCT212630.15014646041176694No Hit
TTCCGTTTGTCATCCTATGCCT212180.14982869759755776No Hit
TCCAGCATCAGTGATTTTGTT210580.1486988742581474No Hit
AACATTCAACGCTGTCGGTGAGA207020.14618501732795933No Hit
AACCCGTAGATCCGAACTTGTG203900.1439818618161091No Hit
TTCACAGTGGTTAAGTTCTGC201510.14229418820286488No Hit
TTCCAGTGATGACAGCCTATAATCTGACT198420.14011221687862857No Hit
CACCACGTTCCCGTGG198090.13987919081487518No Hit
TCCAGCATCAGTGATTTTGTTG196640.13885528841353456No Hit
TACCATGTAGAACCGAATTTGC194390.13726647434248873No Hit
TATTGCACTTGTCCCGGCCTGTAT192730.13609428262785045No Hit
CCACGTTCCCGTGG191230.13503507324715325No Hit
TATTGCACTTGTCCCGGCCTGTA189990.1341594601591102No Hit
TTCAAGTAATCCAGGATGGGCT187170.13216814652339942No Hit
TCCCTGAGACCCTTAACCTGTG185590.13105244597573168No Hit
ATGACCTATGAATTGACAGCCA179050.1264342930758918No Hit
TTCCCTTTGTCATCCTATGCC176690.12476780365026148No Hit
ACAGTAGTCTGCACATTGGTTA175200.12371565566543558No Hit
TTTGGTCCCCTTCAACCAGCTG172140.12155486852881325No Hit
CTTCCCTTTGTCATCCTATGCCT167980.11861732784634628No Hit
AACACTCAACGCTGTCGGTGAG167040.11795355663444268No Hit
TGAGGTAGTAGGTTGTATAGTTT166300.1174310133399654No Hit
TGAGATGAAGCACTGTAGCTC166260.11740276775648013No Hit
ACCCTGTAGAACCGAATTTGC165930.11716974169272674No Hit
TATGTGCCCTTGGACTACATCG164800.11637180395926817No Hit
AACACTCAACGCTGTCGGTGAGT161410.11397799075889244No Hit
TACCATGTAGAACCGAATTTGCG158930.11222676458280637No Hit
TGAGATGAAGCACTGTAGCTCT156040.11018602117599641No Hit
TCCAGTGATGACAGCCTATAATCTGACT152600.1077569009962641No Hit
TTCCCTTTGTCATCCTATGCCA152530.10770747122516489No Hit
CATTATTACTTTTGGTACGCG151140.10672593719905214No Hit
TCCCTGAGACCCTTAACCTGTGA150020.10593506086146488No Hit
TACAGTACTGTGATAACTGAAG149250.10539133337937365No Hit
AACATTCAACGCTGTCGGTGG148730.10502414079406526No Hit
TATTGCACTTGTCCCGGCCTGTTT147030.10382370349594175No Hit
TGTAAACATCCTTGACTGGAAGCT143260.10116155725245606No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTGC2650.01263.881623
AATAACC1300.01145.05523
TAACTAA1300.01145.05523
CCTAGAA100.009453592930.3573623
AGGGTGC50.009735773916.868322
ATAACTA11050.0887.827222
GATTCCT3250.0887.4176623
CAACCCG10150.0852.445623
TCTGACT59700.0824.3869623
ACAACCC10150.0817.5032322
TAATAAC1700.0647.201122
GCTGAGC3550.0628.9739423
GACAACC16650.0589.47821
GATAACA3750.0523.4565421
GATAAAA2850.0508.100621
CGATAAA6250.0495.0046420
ATAAAAA1250.0476.771522
CGATAAC30850.0474.296720
AGACAAC19450.0460.240220
TCGGATA858.589268E-9437.8152223