FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_12_JM105_5_CATGGC_L004_R1_001_TRIMMED_prinseq_good_f87J.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_12_JM105_5_CATGGC_L004_R1_001_TRIMMED_prinseq_good_f87J.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17944313
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT11232536.25966009398075No Hit
TTCCCTTTGTCATCCTATGCCT10743735.987261813812543No Hit
AACATTCAACGCTGTCGGTGAG8391074.676172333819634No Hit
AACATTCAACGCTGTCGGTGAGT7748814.3182539225658845No Hit
TACCCTGTAGAACCGAATTTGT4469262.490627531965141No Hit
TCCTTCATTCCACCGGAGTCTG4299082.39578968556779No Hit
AAGCTGCCAGCTGAAGAACTGT3983512.2199289546498657No Hit
AACAGTAAGAGTTTATGTGCTG3730702.079043092928662No Hit
TGAGGTAGTAGGTTGTATAGTT3450971.9231552637317462No Hit
TACCCTGTAGAACCGAATTTGC3078811.7157580788966398No Hit
TAGCTTATCAGACTGGTGTTGGC2756451.5361134193323533No Hit
TACCCTGTAGAACCGAATTTGCG2657021.4807031063267788No Hit
CCTGTCTGAGGGTCGCT2353101.3113346830274306No Hit
AACATTCAACGCTGTCGGTGA1957061.0906296607733046No Hit
TCCTTCATTCCACCGGAGTCTGT1921571.070851806920666No Hit
TATTGCACTTGTCCCGGCCTGT1532350.8539474317016205No Hit
ACAGTAGTCTGCACATTGGTT1371430.7642699946216943No Hit
TTGGTCCCCTTCAACCAGCTGT1346920.7506110710396101No Hit
TTCACAGTGGCTAAGTTCTG1323210.7373979711566556No Hit
TTCACAGTGGTTAAGTTCTG1160270.6465948292364272No Hit
TAACGGAACCCATAATGCAGCTG1048850.5845027335401473No Hit
AAGCTGCCAGCTGAAGAACT969220.5401265570880311No Hit
ACCCTGTAGAACCGAATTTGCG962260.5362478909056033No Hit
TTCACAGTGGCTAAGTTCTGC878900.48979306145629536No Hit
TTCAAGTAATCCAGGATAGGTT826580.4606361915332173No Hit
TTTGGTCCCCTTCAACCAGCTGT812530.452806412817253No Hit
TTCCCTTTGTCATCCTATGCCTG803490.4477686050170881No Hit
TACCCTGTAGATCCGGATTTGT764330.4259455349446925No Hit
TTCACAGTGGCTAAGTTCAGT764300.42592881655597514No Hit
TCCTTCATTCCACCGGAGTCT710580.3959917551594201No Hit
TTAGGTAGTAGGTTGTATAGTT685780.38217122048640145No Hit
TGAGGTAGTAGTTTGTATAGTT647150.3606435086146792No Hit
TTCAAGTAATCCAGGATAGGC635370.35407875464499533No Hit
AAGCTGCCAGCTGAAGAACTGC614700.34255978481873334No Hit
CTACGCCTGTCTGAGGGTCGCT606730.3381182662161544No Hit
CTGTCTGAGGGTCGCT588510.32796463146847693No Hit
AACATTAAGAGTTTATGTGCTG550710.3068994616846017No Hit
CCACGTTCCCGTGG549890.3064424923929938No Hit
TGAGGTAGTAGGTTGTATAGT518780.28910552329309014No Hit
TTCAAGTAATCCAGGATAGGCTT493240.2748726016983766No Hit
TAGCTTATCAGACTGGTGTTGG451900.25183466204585264No Hit
TGAGGTAGTAGGTTGTATAGTTT428760.23893921154852796No Hit
TTCACGTAATCCAGGATAGGCT424430.2365261907769888No Hit
TTCAGTCATTGTTTCTGGTTGT413690.23054100761617344No Hit
TACCCTGTAGAACCGAATTTG379660.2115767820144466No Hit
CATTGCACTTGTCTCGGTCTGA371810.20720213696673703No Hit
ACAGTAGTCTGCACATTGGTTA362220.20185782537342056No Hit
CACCACGTTCCCGTGG359900.2005649366459446No Hit
AACATTCAACGCTGTCGGTGAGA332970.18555739637399327No Hit
TTCCAGTGATGACAGCCTATAATCTGACT332250.1851561550447766No Hit
TGAGATGAAGCACTGTAGCTCT331590.18478835049299464No Hit
TACCCTGTAGAACCGAATGTGT330060.18393571266840922No Hit
TATGTGCCCTTGGACTACATCG329190.18345087939560573No Hit
AACATTCATTGCTGTCGGTGGG320410.17855796429765797No Hit
TACAGTAGTCTGCACATTGGTT319130.17784464637905056No Hit
TTCAAGTAATCCAGGATGGGCT317800.17710346447924755No Hit
TGAGATGAAGCACTGTAGCTC314500.1752644417203378No Hit
TGTCTGAGGGTCGCT312930.1743895127107959No Hit
TTCACAGTGGTTAAGTTCTGCC311690.17369848597714496No Hit
AACATTCATTGCTGTCGGTGGGT308610.17198206473549588No Hit
TATTGCACTTGTCCCGGCCTGTT300380.16739565343069973No Hit
TCAGTAACTGGAATCTGTCCCT289300.1612209951977543No Hit
TTCACAGTGGTTAAGTTCTGC285650.15918692457047534No Hit
TGAGGTAGTAGATTGAATAGTT283230.15783830788060818No Hit
TTTCCTTTGTCATCCTATGCCT270460.1507218470832514No Hit
TTCACAGTGGCTAAGTTCTGCT259370.14454161605406682No Hit
TTCCATTTGTCATCCTATGCCT257770.14364996865580756No Hit
ACCCTGTAGAACCGAATTTGC249390.13897996540742463No Hit
ACCCTGTAGAACCGAATTTGTG240550.13405361353204215No Hit
TCCCTGAGACCCTTAACCTGTG237950.13260468650987084No Hit
TGTAAACATCCTTGACTGGAAGCT236670.13189136859126344No Hit
TTCCCTTTGTCATCCTATGCC234990.1309551388230912No Hit
TTTGGTCCCCTTCAACCAGCTG234200.1305148879202007No Hit
TGAGTTAGTAGGTTGTATAGTT230720.12857555482898678No Hit
TTTAAGTAATCCAGGATAGGCT228750.12747771396988003No Hit
ATGACCTATGAATTGACAGCC228140.1271377733992937No Hit
AACCCGTAGATCCGAACTTGTG227240.12663622173777284No Hit
TACCCTGTAGATCCGGATTTGTG216190.12047828189354476No Hit
TACAGTACTGTGATAACTGAAG214160.11934700425700333No Hit
TGTAAACATCCTACACTCTCAGCT207960.11589187058874864No Hit
CATAAAGTAGAAAGCACTACT207540.11565781314670559No Hit
TATTGCACTTGTCCCGGCCTGTA206320.11497793200553288No Hit
TCCCTGAGACCCTTAACCTGTGA205300.1144095067891426No Hit
TATTGCACTTGTCCCGGCCTGTAT204000.11368504327805694No Hit
AACATTCAACGCTGTCGGTGG202540.11287141502714537No Hit
TCCAGTGATGACAGCCTATAATCTGACT200890.1119519036476905No Hit
AAGCTGCCAGCTGAAGAACTG198790.11078161643747521No Hit
TCCAGCATCAGTGATTTTGTT194360.10831286770354485No Hit
TGAGATGAAGCACTGTAGCT186570.10397165943327003No Hit
CATTATTACTTTTGGTACGCG186330.10383791232353114No Hit
TCCAGCATCAGTGATTTTGTTG186200.10376546597242259No Hit
ACCACGTTCCCGTGG182610.10176483212257834No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAACCCG8700.01268.572423
GATTCCT12100.01203.483823
TAACTGC1750.01138.694623
TAACTAA1400.0821.174123
AATAACC1750.0788.32723
TCTGACT79600.0734.65523
ATAACTA10500.0722.432922
ACAACCC16250.0678.1413622
CATAGCT750.0613.143323
GGATTCC21850.0545.79122
TAATAAC2000.0528.3464422
AAATAGC1850.0497.1432523
GACAACC28350.0489.726921
GATAAAA6000.0441.595421
ATAAAAA2000.0433.9988422
GCATAGC1100.0411.6985222
CGATAAA14000.0404.7710620
GATAACA4850.0404.2646521
TCTGAGA26950.0398.14523
CGATAAC29100.0380.879220