FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_12_JM109_5_CACTCA_L002_R1_001_TRIMMED_prinseq_good_cTut.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_12_JM109_5_CACTCA_L002_R1_001_TRIMMED_prinseq_good_cTut.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences21603540
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT10103714.676877030338546No Hit
TTCCCTTTGTCATCCTATGCCT9037504.1833421744769606No Hit
AACATTCAACGCTGTCGGTGAG8854974.098851391947801No Hit
AACATTCAACGCTGTCGGTGAGT7433943.4410749349412177No Hit
TACCCTGTAGAACCGAATTTGT6153612.848426693032716No Hit
TAGCTTATCAGACTGGTGTTGGC5114932.3676351190591913No Hit
AACAGTAAGAGTTTATGTGCTG4769342.207665965855596No Hit
AAGCTGCCAGCTGAAGAACTGT4623352.140089077993699No Hit
TCCTTCATTCCACCGGAGTCTG3665551.6967358127418004No Hit
TAACGGAACCCATAATGCAGCTG3589801.6616721148478442No Hit
TACCCTGTAGAACCGAATTTGC3296271.52580086411764No Hit
TGAGGTAGTAGGTTGTATAGTT2988451.3833149567154273No Hit
TACCCTGTAGAACCGAATTTGCG2940191.3609760252254954No Hit
CCTGTCTGAGGGTCGCT2291881.06088168883433No Hit
TATTGCACTTGTCCCGGCCTGT2125810.9840100279861541No Hit
TTGGTCCCCTTCAACCAGCTGT1880580.8704962242299179No Hit
AACATTCAACGCTGTCGGTGA1670280.7731510669084789No Hit
TTCACGTAATCCAGGATAGGCT1647930.7628055402031333No Hit
TCCTTCATTCCACCGGAGTCTGT1628670.7538903346396006No Hit
TTCACAGTGGTTAAGTTCTG1589530.7357729335099711No Hit
TTCACAGTGGCTAAGTTCTG1573230.728227873765133No Hit
TTTGGTCCCCTTCAACCAGCTGT1515780.7016350098178354No Hit
ACCCTGTAGAACCGAATTTGCG1352050.6258465047857897No Hit
AAGCTGCCAGCTGAAGAACT1059530.49044277002750475No Hit
ACAGTAGTCTGCACATTGGTT1047240.48475388755731696No Hit
TTCACAGTGGCTAAGTTCTGC1035960.47953252105904864No Hit
CCTTTCTGAGGGTCGCT1001690.46366938011085224No Hit
TTCCATTTGTCATCCTATGCCT870330.4028645305352734No Hit
TTAGGTAGTAGGTTGTATAGTT852600.39465754223613353No Hit
AAGCTGCCAGCTGAAGAACTGC812050.37588747029422026No Hit
CTACGCCTGTCTGAGGGTCGCT782830.36236190920562095No Hit
TTATGTAGTAGGTTGTATAGTT779530.3608343817726169No Hit
TTCCCTTTGTCATCCTATGCCTG760250.35190991846706604No Hit
TTCAAGTAATCCAGGATAGGTT758730.35120633007368235No Hit
TACCCTGTAGAACCGAATGTGT728380.33715770656105437No Hit
TGATGTAGTAGGTTGTATAGTT727820.33689848978454456No Hit
TTGTTCCCCTTCAACCAGCTGT716250.33154288602701226No Hit
TAGCTTATCAGACTGGTGTTGG693090.3208224207699294No Hit
TTCACAGTGGCTAAGTTCAGT647070.29952035638603675No Hit
TTCAAGTAATCCAGGATAGGC614380.28438857705727855No Hit
CTGTCTGAGGGTCGCT604380.27975970604817546No Hit
TACCATGTAGAACCGAATTTGT601580.27846362216562653No Hit
TTTTGTCCCCTTCAACCAGCTGT569560.2636419771944783No Hit
TCCAGCATCAGTGATTTTGTT550390.2547684314700276No Hit
TGAGGTAGTAGTTTGTATAGTT548020.25367138904087017No Hit
TCCTTCATTCCACCGGAGTCT541770.2507783446601807No Hit
CATTGCACTTGTCTCGGTCTGA524430.24275188233039585No Hit
TCCAGCATCAGTGATTTTGTTG488660.22619441073083393No Hit
TTCAGTCATTGTTTCTGGTTGT487910.22584724540515116No Hit
TTCACAGTGGTTAAGTTCTGCC473740.21928813518525206No Hit
TACCCTGTAGATCCGGATTTGT473670.21925573308818835No Hit
TTTGGTCCCCTTCAACCAGCTG451610.2090444436421068No Hit
ATGACCTATGAATTGACAGCC447370.20708180233424706No Hit
TACCCTGTAGAACCGAATTTG426810.19756484353953102No Hit
ACCCTGTAGAACCGAATTTGTG422940.19577347045900811No Hit
ACATTAGTCTGCACATTGGTT422660.19564386207075324No Hit
TGAGGTAGTAGGTTGTATAGT419710.1942783451230678No Hit
TACAGTAGTCTGCACATTGGTT410810.190158649924966No Hit
AACATTCATTGCTGTCGGTGGG406620.18821915297215178No Hit
TATTGCACTTGTCCCGGCCTGTT404900.18742298715858605No Hit
TTCAAGTAATCCAGGATAGGCTT400920.18558069649696302No Hit
TTCACAGTGGTTAAGTTCTGC375370.1737539310687045No Hit
TTCAAGTAATCCAGGATGGGCT360250.16675507810294052No Hit
AACATTCATTGCTGTCGGTGGGT341580.158112975928945No Hit
TGTCTGAGGGTCGCT341120.15790004786252623No Hit
TGAGATGAAGCACTGTAGCTC339240.15702982011281483No Hit
ATGACCTATGAATTGACAGCCA328380.15200286619692882No Hit
TGTAAACATCCTTGACTGGAAGCT325550.15069289570135264No Hit
TGAGGTAGTAGGTTGTATAGTTT325370.15060957602318878No Hit
ACCCTGTAGAACCGAATTTGC323680.14982729682265036No Hit
TATGTGCCCTTGGACTACATCG322630.14934126536669454No Hit
TTCCAGTGATGACAGCCTATAATCTGACT320780.14848492423001045No Hit
TACCATGTAGAACCGAATTTGC310570.14375884692971616No Hit
CATTATTACTTTTGGTACGCG310380.1436708983805432No Hit
AACCCGTAGATCCGAACTTGTG302170.1398705952820695No Hit
TATTGCACTTGTCCCGGCCTGTA301220.1394308525362047No Hit
ACAGTAGTCTGCACATTGGTTA300540.1391160893075857No Hit
TTCACAGTGGCTAAGTTCTGCT299700.13872726414282105No Hit
AACATTCAACGCTGTCGGTGAGA295660.13685720025514336No Hit
TCCAGTGATGACAGCCTATAATCTGACT283990.13145530778752No Hit
TACCATGTAGAACCGAATTTGCG277040.12823824243619333No Hit
TATTGCACTTGTCCCGGCCTGTAT277030.12823361356518423No Hit
TACAGTACTGTGATAACTGAAG266570.12339181448966234No Hit
TGAGATGAAGCACTGTAGCTCT264400.12238734948068697No Hit
ACCCTGTAGAACCGAATTTGT248270.1149209805430036No Hit
TCCCTGAGACCCTTAACCTGTG247990.11479137215474872No Hit
CATAAAGTAGAAAGCACTACT246570.11413407247145607No Hit
CCACGTTCCCGTGG240740.11143544067314894No Hit
TGTAAACATCCTACACTCTCAGCT239830.11101421341132055No Hit
TGAGGTAGTAGATTGAATAGTT232240.10750090031541126No Hit
AACACTAAGAGTTTATGTGCTG229710.10632979595010818No Hit
AACACTCAACGCTGTCGGTGAG227010.10508000077765034No Hit
AATGACACGTTTTCTCCCGGATT226110.10466340238683104No Hit
TACCCTGTAGAACCGAATTTGTG224240.10379780350812877No Hit
CTTCCCTTTGTCATCCTATGCCT222560.10302015317859943No Hit
AAGCTGCCAGCTGAAGAACTG220920.10226101833310651No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AATAACC2500.01153.9923
GATTCCT12450.01100.693223
TAACTGC5250.0865.492523
TAACTAA2150.0805.1092523
CAACCCG18550.0762.0688523
ATAACTA20900.0654.5644522
TCTGACT94200.0619.4120523
AAATAGC1750.0618.208923
ACAACCC21750.0603.69822
GCTGAGC4400.0590.108523
TAATAAC3700.0520.2378522
GCATAGC1750.0451.7575722
GGATTCC19450.0450.6467622
GACAACC35300.0446.165621
TCTGAGA28300.0443.450223
GGACACT1750.0370.9253523
CGATAAA9200.0369.3374620
CGATAAC57600.0359.9138220
GATAAAA5450.0353.9497721
ATAAAAA1750.0353.549422