FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_12_JM110_5_CAGGCG_L003_R1_001_TRIMMED_prinseq_good_JYwG.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_12_JM110_5_CAGGCG_L003_R1_001_TRIMMED_prinseq_good_JYwG.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14695169
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT8275855.631680724461216No Hit
AACATTCAACGCTGTCGGTGAG7725785.257360429131506No Hit
AACATTCAACGCTGTCGGTGAGT6393144.350504577388664No Hit
TTCCCTTTGTCATCCTATGCCT5211023.5460769454233563No Hit
TCCTTCATTCCACCGGAGTCTG4223832.874298349341882No Hit
TGAGGTAGTAGGTTGTATAGTT3673642.499896394522581No Hit
AAGCTGCCAGCTGAAGAACTGT3293272.2410562273901036No Hit
AACAGTAAGAGTTTATGTGCTG3264872.2217301481867953No Hit
TACCCTGTAGAACCGAATTTGT3231532.199042419995306No Hit
TAGCTTATCAGACTGGTGTTGGC2813641.9146700524505706No Hit
CCTGTCTGAGGGTCGCT2502331.7028249215779687No Hit
TACCCTGTAGAACCGAATTTGC2174191.4795270472901672No Hit
TACCCTGTAGAACCGAATTTGCG1917771.3050343279481849No Hit
TATTGCACTTGTCCCGGCCTGT1830661.2457563434622632No Hit
AACATTCAACGCTGTCGGTGA1721321.1713509385295262No Hit
TCCTTCATTCCACCGGAGTCTGT1550191.0548977014146623No Hit
TAACGGAACCCATAATGCAGCTG1386260.9433440336752847No Hit
ACAGTAGTCTGCACATTGGTT1171960.7975137951798988No Hit
TTCACAGTGGTTAAGTTCTG1099710.7483479774883841No Hit
TTCACAGTGGCTAAGTTCTG998250.6793048790388189No Hit
TTGGTCCCCTTCAACCAGCTGT819390.5575914098027726No Hit
ACCCTGTAGAACCGAATTTGCG806610.5488946741612839No Hit
TACCCTGTAGATCCGGATTTGT786410.5351486600800576No Hit
TTCACGTAATCCAGGATAGGCT776200.5282007985073189No Hit
AAGCTGCCAGCTGAAGAACT762840.5191093753328049No Hit
TTTGGTCCCCTTCAACCAGCTGT762610.5189528613110881No Hit
CTACGCCTGTCTGAGGGTCGCT730650.4972042172499003No Hit
TTCAAGTAATCCAGGATAGGTT718940.4892356120572686No Hit
TGAGGTAGTAGTTTGTATAGTT691370.4704743443236345No Hit
TTCACAGTGGCTAAGTTCAGT660790.4496647843927484No Hit
TTCACAGTGGCTAAGTTCTGC634920.43206035942832643No Hit
CTGTCTGAGGGTCGCT629990.42870551539761126No Hit
TGAGGTAGTAGGTTGTATAGT594020.40422808339257615No Hit
TTCCCTTTGTCATCCTATGCCTG536130.3648341846221707No Hit
TTCAGTCATTGTTTCTGGTTGT527760.3591384352231676No Hit
TGTCTGAGGGTCGCT516930.35176866628753983No Hit
TTCAAGTAATCCAGGATAGGC507020.34502495343877976No Hit
TCCTTCATTCCACCGGAGTCT497720.3386963429954429No Hit
AAGCTGCCAGCTGAAGAACTGC493530.33584506581720835No Hit
ATGACCTATGAATTGACAGCC471480.32084013460478067No Hit
TGATGTAGTAGGTTGTATAGTT450450.3065293090538802No Hit
TAGCTTATCAGACTGGTGTTGG428000.2912521795428144No Hit
CATTGCACTTGTCTCGGTCTGA426900.2905036342215595No Hit
TATGTGCCCTTGGACTACATCG381420.25955468766640244No Hit
TGAGGTAGTAGGTTGTATAGTTT378900.25783983838498215No Hit
ATGACCTATGAATTGACAGCCA368220.25057214381134374No Hit
AACATTCATTGCTGTCGGTGGG365330.24860551110368312No Hit
CCTTTCTGAGGGTCGCT363010.2470267609715819No Hit
TACAGTAGTCTGCACATTGGTT357340.24316835008838616No Hit
CCACGTTCCCGTGG348980.23747940564684897No Hit
ACAGTAGTCTGCACATTGGTTA347250.23630214800523902No Hit
TATTGCACTTGTCCCGGCCTGTT340310.2315795075238672No Hit
TTCAAGTAATCCAGGATAGGCTT338100.23007561192389145No Hit
TGTAAACATCCTTGACTGGAAGCT333120.22668674310584655No Hit
AACATTCATTGCTGTCGGTGGGT312410.2125936761938566No Hit
TTCACAGTGGTTAAGTTCTGCC305320.20776896135049552No Hit
TGAGGTAGTAGATTGAATAGTT303610.20660531362381748No Hit
AACATTCAACGCTGTCGGTGAGA303270.20637394506997503No Hit
TGAGATGAAGCACTGTAGCTC290900.19795621268459043No Hit
TTCCATTTGTCATCCTATGCCT290700.19782011353527135No Hit
TACCCTGTAGAACCGAATTTG288200.19611887416878296No Hit
TGAGATGAAGCACTGTAGCTCT280640.19097432632452202No Hit
TGGACGGAGAACTGATAAGGGC277800.1890417184041912No Hit
TCAGTAACTGGAATCTGTCCCT272590.18549633556442938No Hit
TTCCAGTGATGACAGCCTATAATCTGACT270310.18394480526219195No Hit
TTCACAGTGGTTAAGTTCTGC268450.18267908317352458No Hit
AACATTCAACGCTGTCGGTGG248450.16906916824161738No Hit
TGAAATGTTTAGGACCACTTGT240060.1633598089276823No Hit
TATTGCACTTGTCCCGGCCTGTA239560.16301956105438462No Hit
TACCCTGTAGATCCGGATTTGTG239230.16279499745800813No Hit
TCCAGCATCAGTGATTTTGTTG228350.1553912037350506No Hit
TATTGCACTTGTCCCGGCCTGTAT226700.15426838575316826No Hit
TTAGGTAGTAGGTTGTATAGTT226230.15394855275226846No Hit
TCCAGCATCAGTGATTTTGTT224450.1527372703233287No Hit
ACCCTGTAGAACCGAATTTGTG224400.15270324553599893No Hit
CACCACGTTCCCGTGG220800.15025346084825564No Hit
TACAGTACTGTGATAACTGAAG220200.14984516340029844No Hit
TCCAGTGATGACAGCCTATAATCTGACT219670.14948450065460286No Hit
TGTAAACATCCTACACTCTCAGCT218630.1487767850781437No Hit
CATTATTACTTTTGGTACGCG213790.14548318566462215No Hit
CATAAAGTAGAAAGCACTACT199870.13601068487201473No Hit
AACCCGTAGATCCGAACTTGTG198720.13522811476343008No Hit
TTTGGTCCCCTTCAACCAGCTG193900.13194812526484043No Hit
TTCACAGTGGCTAAGTTCTGCT181600.1235780275817175No Hit
TACCATGTAGAACCGAATTTGT180990.12316292517629433No Hit
GTGAAATGTTTAGGACCACTTG180660.12293836157991787No Hit
ACCCTGTAGAACCGAATTTGC180190.12261852857901805No Hit
TGAGGTAGTTGGTTGTATAGTT174920.1190323159944605No Hit
TCCCTGAGACCCTTAACCTGTG173540.1180932318641589No Hit
TGTAAACATCCCCGACTGGAAGCT173500.11806601203429506No Hit
TTCAAGTAATCCAGGATGGGCT170560.11606535453930471No Hit
TATTGCACTTGTCCCGGCCTGTTT167880.11424162593842914No Hit
ACATTAGTCTGCACATTGGTT167490.11397623259725696No Hit
TGAGGTAGTAGTTTGTGCTGTT165780.11281258487057891No Hit
TACCCTGTAGAACCGAATGTGT165180.11240428742262168No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT163310.11113176037648835No Hit
TGAGATGAAGCACTGTAGCT159860.10878405005073435No Hit
ACCACGTTCCCGTGG153590.10451734171958145No Hit
TAACACTGTCTGGTAACGATGT153000.10411584922909017No Hit
TGAGGTAGTAGGTTGTGTGGTT150550.10244863464993156No Hit
TGAGAACTGAATTCCATAGATGG148390.10097876383728557No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TTTCGCC50.00431729571376.951523
GGTTACG50.00431729571376.951523
GATTCCT22000.01161.020523
TAACTGC2950.01050.217323
CAACCCG3450.01037.702523
CATAGCT1900.0942.1247623
TAACTAA1000.0895.018523
AATAACC1500.0872.0693423
ATAACTA10800.0681.432622
ACAACCC8050.0641.712222
AAATAGC2350.0615.233723
GGATTCC30950.0586.462222
TCTGACT73250.0574.278123
GCATAGC2550.0568.888322
TAATAAC1900.0502.7979422
GACAACC12500.0491.4389321
TTCTCGC30750.0474.6564623
GATAAAA6300.0419.0757421
CGATAAA11850.0416.5286320
TAAAAAA501.8846458E-6413.0854523