FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_12_JM116_5_CATTTT_L006_R1_001_TRIMMED_prinseq_good_rE8G.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_12_JM116_5_CATTTT_L006_R1_001_TRIMMED_prinseq_good_rE8G.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences32007277
Sequences flagged as poor quality0
Sequence length12-29
%GC48

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT20773936.490377172666078No Hit
AACATTCAACGCTGTCGGTGAGT16336905.104120541088203No Hit
AACATTCAACGCTGTCGGTGAG16234225.072040336327268No Hit
TCCTTCATTCCACCGGAGTCTG15166914.738581791884389No Hit
AAGCTGCCAGCTGAAGAACTGT9360842.9245974282660785No Hit
TTCCCTTTGTCATCCTATGCCT8888202.776931008532841No Hit
CCTGTCTGAGGGTCGCT8364842.6134181923691915No Hit
TGAGGTAGTAGGTTGTATAGTT7695142.404184523413223No Hit
TCCTTCATTCCACCGGAGTCTGT6982062.181397686532347No Hit
TAGCTTATCAGACTGGTGTTGGC6354411.9853016549955187No Hit
AACAGTAAGAGTTTATGTGCTG4988071.558417481124683No Hit
TACCCTGTAGAACCGAATTTGT4693011.4662321946349888No Hit
TATTGCACTTGTCCCGGCCTGT4422731.3817888975685124No Hit
AACATTCAACGCTGTCGGTGA4285971.339061114133514No Hit
TACCCTGTAGAACCGAATTTGC3764331.176085675766795No Hit
TACCCTGTAGAACCGAATTTGCG3119840.9747283406832764No Hit
TTGGTCCCCTTCAACCAGCTGT2902440.9068062865828918No Hit
TAACGGAACCCATAATGCAGCTG2883170.9007857806835615No Hit
ACAGTAGTCTGCACATTGGTT2748630.8587515895213454No Hit
TTTGGTCCCCTTCAACCAGCTGT2480050.7748394216727652No Hit
CTACGCCTGTCTGAGGGTCGCT2005060.6264387939030239No Hit
AAGCTGCCAGCTGAAGAACT1985980.6204776495045173No Hit
CTGTCTGAGGGTCGCT1920180.5999198244824139No Hit
TTCAAGTAATCCAGGATAGGTT1749370.5465538352419045No Hit
TTCACAGTGGTTAAGTTCTG1694330.5293577457401327No Hit
TTCACAGTGGCTAAGTTCTG1559540.48724544733999087No Hit
TACCCTGTAGATCCGGATTTGT1527240.4771539921999613No Hit
TTCACAGTGGCTAAGTTCAGT1390870.4345480560561275No Hit
TCCTTCATTCCACCGGAGTCT1342600.41946711055738983No Hit
TGTCTGAGGGTCGCT1317790.41171574826562096No Hit
TTCCCTTTGTCATCCTATGCCTG1288170.40246160271615733No Hit
AAGCTGCCAGCTGAAGAACTGC1275070.39836878344883886No Hit
ACCCTGTAGAACCGAATTTGCG1267640.39604743633768036No Hit
TGAGGTAGTAGTTTGTATAGTT1263780.394841460584104No Hit
TGAGGTAGTAGGTTGTATAGT1260520.39382294220154995No Hit
TTCAAGTAATCCAGGATAGGC1257860.3929918811900181No Hit
TTCACAGTGGCTAAGTTCTGC1160190.3624769454771176No Hit
TTCAGTCATTGTTTCTGGTTGT1141760.3567188798972184No Hit
CACCACGTTCCCGTGG1103360.34472160815179625No Hit
CCACGTTCCCGTGG1057870.33050921513879483No Hit
TATGTGCCCTTGGACTACATCG948010.2961857705046262No Hit
TAGCTTATCAGACTGGTGTTGG913020.28525388148451364No Hit
TTCAAGTAATCCAGGATAGGCTT905670.2829575286894914No Hit
CATTGCACTTGTCTCGGTCTGA857560.26792657182302637No Hit
TGAGGTAGTAGGTTGTATAGTTT856380.26755790566001597No Hit
TATTGCACTTGTCCCGGCCTGTT845840.264264904509059No Hit
TGAGGTAGTAGATTGAATAGTT808570.25262067747906203No Hit
AACATTCATTGCTGTCGGTGGGT780580.2438757911208754No Hit
TTCACAGTGGTTAAGTTCTGCC746190.23313135947178512No Hit
AACATTCATTGCTGTCGGTGGG733690.22922599757548884No Hit
AACATTCAACGCTGTCGGTGAGA696210.21751616046563413No Hit
TACAGTAGTCTGCACATTGGTT691520.21605086868214377No Hit
CCTTTCTGAGGGTCGCT670220.2093961320108549No Hit
TGAGATGAAGCACTGTAGCTCT632580.19763630626872755No Hit
ACAGTAGTCTGCACATTGGTTA626380.19569924676816464No Hit
AACATTCAACGCTGTCGGTGG616720.19268118309470686No Hit
TGAGATGAAGCACTGTAGCTC615550.19231564122121353No Hit
TGGACGGAGAACTGATAAGGGC602360.1881947033482417No Hit
ACCACGTTCCCGTGG599930.18743550099560172No Hit
TTCCAGTGATGACAGCCTATAATCTGACT568600.17764710193872474No Hit
TGTAAACATCCTTGACTGGAAGCT555570.1735761526980255No Hit
TATTGCACTTGTCCCGGCCTGTAT542450.16947708485167295No Hit
TATTGCACTTGTCCCGGCCTGTA530730.16581541753770557No Hit
TTCACGTAATCCAGGATAGGCT527410.16477815341804927No Hit
TTCACAGTGGTTAAGTTCTGC514270.16067283699266263No Hit
CACGTTCCCGTGG508710.15893573202119007No Hit
TACCCTGTAGAACCGAATTTG506180.1581452867733797No Hit
CATAAAGTAGAAAGCACTACT478900.14962222497090272No Hit
TAACACTGTCTGGTAACGATGT471390.1472758835436079No Hit
TTCAAGTAATCCAGGATGGGCT463420.14478582479852942No Hit
TACCCTGTAGATCCGGATTTGTG458110.14312682706498275No Hit
TTTGGTCCCCTTCAACCAGCTG454630.14203957431305386No Hit
TGAAATGTTTAGGACCACTTGT448960.1402681021568939No Hit
TATTGCACTTGTCCCGGCCTGTTT447920.13994317604712203No Hit
TGTAAACATCCTACACTCTCAGCT419930.13119828968893543No Hit
TACGCCTGTCTGAGGGTCGCT419740.13113892818811174No Hit
TTAGGTAGTAGGTTGTATAGTT413610.12922373871416803No Hit
TTCACAGTGGTTAAGTTCTGCCT389320.12163483947728512No Hit
TCCCTGAGACCCTTAACCTGTGA385310.12038199938095327No Hit
TTCACAGTGGCTAAGTTCTGCT383400.11978526008319922No Hit
GTGAAATGTTTAGGACCACT382640.11954781407990439No Hit
TCCAGTGATGACAGCCTATAATCTGACT376400.1175982574212733No Hit
TCCCTGAGACCCTTAACCTGTG375460.11730457420667181No Hit
TGAGAACTGAATTCCATAGATGG375010.11716398117840515No Hit
TAGCAGCACGTAAATATTGGAG374250.11692653517511034No Hit
AACCCGTAGATCCGAACTTGTG365030.11404594024040221No Hit
GTGAAATGTTTAGGACCACTTG355200.11097476364515482No Hit
TACAGTACTGTGATAACTGAAG351450.10980315507626594No Hit
TGAGGTAGTAGTTTGTGCTGTT343530.10732871777877262No Hit
TCACAGTGAACCGGTCTCTTT342020.10685695006170003No Hit
TGAGGTAGTTGGTTGTATAGTT339700.10613211489374744No Hit
AAGCTGCCAGCTGAAGAACTG336150.1050229921151993No Hit
GAAGGATCATTA333840.10430128123676374No Hit
TCCAGCATCAGTGATTTTGTTG331430.10354832746315784No Hit
TCCTTCATTCCACCGGAGTC331040.10342648017199339No Hit
TAATACTGTCTGGTAATGCCG324980.10153316072466895No Hit
TGTAAACATCCCCGACTGGAAGCT321600.10047715086791045No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AGCTATT50.0028866941684.115523
CAACCCG14750.01450.05223
AATAACC1200.01403.429623
TAACTAA1800.01263.086723
GATTCCT16450.01249.009623
ATAACTA19600.0816.616722
ACAACCC30350.0792.4654522
TCTGACT139250.0753.4678323
TAATAAC1800.0665.7148422
GAGCGCA403.4593177E-7631.5433323
ATAAAAA2850.0630.6772522
ATAACCA357.2759576E-12611.370822
GGACACT2950.0599.4309723
AAATAGC2150.0587.482123
GACAACC46550.0562.3901421
GATAAAA11250.0530.823721
GGATTCC25200.0529.854722
TAAAAAA1300.0518.189423
GCTGAGC6250.0498.498223
GATAACA7150.0489.316221