FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_20_JM79_5_CCAACA_L001_R1_001_TRIMMED_prinseq_good_VL_E.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_20_JM79_5_CCAACA_L001_R1_001_TRIMMED_prinseq_good_VL_E.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences21818342
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT10962355.0243735293910055No Hit
TTCCCTTTGTCATCCTATGCCT9896484.535853365943205No Hit
AACATTCAACGCTGTCGGTGAG7729903.542844822947592No Hit
AACATTCAACGCTGTCGGTGAGT7543843.4575679490219744No Hit
TCCTTCATTCCACCGGAGTCTG5900622.7044309783025673No Hit
AAGCTGCCAGCTGAAGAACTGT4176771.914338862228853No Hit
AACAGTAAGAGTTTATGTGCTG3842651.761201653177863No Hit
TACCCTGTAGAACCGAATTTGT3566411.6345925826994554No Hit
TAGCTTATCAGACTGGTGTTGGC3190501.4623017642678806No Hit
TACCCTGTAGAACCGAATTTGC3010221.3796740375597742No Hit
TCCTTCATTCCACCGGAGTCTGT2411711.1053589681562421No Hit
TGAGGTAGTAGGTTGTATAGTT2199651.0081655150515103No Hit
TATTGCACTTGTCCCGGCCTGT2094360.9599079526757808No Hit
AACATTCAACGCTGTCGGTGA2081030.9537984141966425No Hit
TACCCTGTAGAACCGAATTTGCG1923750.8817122767623682No Hit
CCTGTCTGAGGGTCGCT1919470.8797506244974985No Hit
TTCACGTAATCCAGGATAGGCT1853090.8493266811932823No Hit
TTCACAGTGGTTAAGTTCTG1586990.7273650765947293No Hit
TTCACAGTGGCTAAGTTCTG1298000.5949122990188713No Hit
TTGGTCCCCTTCAACCAGCTGT1251820.5737466210768902No Hit
ACAACACTGAGACACGAGACGAAGCC1231800.5645708551089721No Hit
TAACGGAACCCATAATGCAGCTG1190600.5456876604097599No Hit
TTCCATTTGTCATCCTATGCCT1134980.5201953475658233No Hit
AAGCTGCCAGCTGAAGAACT1027830.4710852914488186No Hit
TTCAAGTAATCCAGGATAGGTT909520.4168602728841632No Hit
CCTTTCTGAGGGTCGCT903310.4140140437802286No Hit
ACAGTAGTCTGCACATTGGTT897080.41115864807692537No Hit
ACCCTGTAGAACCGAATTTGCG836310.3833059358955873No Hit
TTAGGTAGTAGGTTGTATAGTT804580.3687631259973833No Hit
TCCTTCATTCCACCGGAGTCT795270.36449607399132344No Hit
TTTGGTCCCCTTCAACCAGCTGT772050.3538536521244373No Hit
TTCACAGTGGCTAAGTTCTGC763640.3499990970899622No Hit
TTCAAGTAATCCAGGATAGGC762420.3494399345284807No Hit
CTACGCCTGTCTGAGGGTCGCT722230.3310196530973802No Hit
CTGTCTGAGGGTCGCT679090.3112472982594186No Hit
TGATGTAGTAGGTTGTATAGTT665290.30492234469511936No Hit
TTCACAGTGGCTAAGTTCAGT655300.30034362831052885No Hit
TTCAGTCATTGTTTCTGGTTGT646560.2963378243864726No Hit
TTCAAGTAATCCAGGATAGGCTT596120.27321966077899046No Hit
TTGTTCCCCTTCAACCAGCTGT559030.2562202022500151No Hit
TAGCTTATCAGACTGGTGTTGG558020.25575728898190336No Hit
TTCCCTTTGTCATCCTATGCCTG544560.24958816760686947No Hit
TACCCTGTAGATCCGGATTTGT535610.24548611438944354No Hit
ATGACCTATGAATTGACAGCC529950.242891966768144No Hit
AAGCTGCCAGCTGAAGAACTGC529650.24275446777761575No Hit
TATTGCACTTGTCCCGGCCTGTT482380.22108921017004865No Hit
TACCCTGTAGAACCGAATTTG437510.20052394448670757No Hit
TTATGTAGTAGGTTGTATAGTT428090.19620647618412068No Hit
TGAGGTAGTAGGTTGTATAGT421820.19333274728208036No Hit
CATTGCACTTGTCTCGGTCTGA420700.19281941771744157No Hit
ATGACCTATGAATTGACAGCCA419140.19210442296669472No Hit
TCCAGCATCAGTGATTTTGTT411220.18847444961674906No Hit
ACATTAGTCTGCACATTGGTT410500.1881444520394813No Hit
TTCACAGTGGTTAAGTTCTGCC395800.1814070015035973No Hit
TATTGCACTTGTCCCGGCCTGTAT359440.16474212385157405No Hit
TTCACAGTGGTTAAGTTCTGC357340.16377963091787634No Hit
TGAGGTAGTAGTTTGTATAGTT349440.16015882416729924No Hit
TATTGCACTTGTCCCGGCCTGTA345330.15827508799706227No Hit
AACATTCAACGCTGTCGGTGAGA343050.15723009566904764No Hit
TTCAGGTAATCCAGGATAGGCT335190.15362762211720762No Hit
TACCCTGTAGAACCGAATGTGT326150.1494843192026232No Hit
TACCATGTAGAACCGAATTTGC324130.14855849266639967No Hit
AACATTAAGAGTTTATGTGCTG323630.14832932768218593No Hit
ACCCTGTAGAACCGAATTTGC323520.1482789113856589No Hit
TGTCTGAGGGTCGCT319610.14648684120910746No Hit
TACAGTAGTCTGCACATTGGTT304310.13947439269216697No Hit
TGAGGTAGTAGGTTGTATAGTTT298760.13693066136739446No Hit
TCAGTAACTGGAATCTGTCCCT296090.13570692035169307No Hit
TTCCGTTTGTCATCCTATGCCT290250.1330302733360766No Hit
TTCCAGTGATGACAGCCTATAATCTGACT287020.13154986753805584No Hit
TTTTGTCCCCTTCAACCAGCTGT284050.1301886275318262No Hit
AACATTCATTGCTGTCGGTGGGT281040.1288090543268595No Hit
TCCAGCATCAGTGATTTTGTTG272250.12478033390438191No Hit
AACATTCATTGCTGTCGGTGGG264250.12111369415696208No Hit
TTCACAGTGGCTAAGTTCTGCT262770.12043536580368938No Hit
TTCAAGTAATCCAGGATGGGCT253560.11621414679447228No Hit
TATTGCACTTGTCCCGGCCTGTTT253010.11596206531183717No Hit
TTCACAGTGGTTAAGTTCTGCCT249570.11438541022044664No Hit
CCACGTTCCCGTGG241550.11070960387365822No Hit
ACAGTAGTCTGCACATTGGTTA237150.10869295201257731No Hit
TGAGATGAAGCACTGTAGCTCT232750.10667630015149639No Hit
TTCCCTTTGTCATCCTATGCC228290.10463214849230983No Hit
TCCAGTGATGACAGCCTATAATCTGACT226880.10398590323682708No Hit
CATTATTACTTTTGGTACGCG224190.10275299562175713No Hit
TACAGTACTGTGATAACTGAAG222330.10190050188048203No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GATTCCT25550.0802.535423
GACGTTC3550.0755.322323
TAACTAA3000.0718.543623
TATCTCC22300.0697.874523
GCATTCG1750.0691.003623
ATTCGGC11200.0633.732923
GACTGCC41400.0600.691223
AATAACC1950.0593.169123
CGCACTG10150.0580.1529523
TAACTGC4500.0537.4472723
CGAGCAA201.4981255E-4525.763623
CGAGCAT1850.0511.5537723
ATAACTA19550.0505.6075722
CCCTACG950.0498.091823
CACACTC4250.0470.0944823
CAACCCG10700.0466.7994723
TCTGACT90050.0465.3343523
ACAACCC14150.0460.7126822
ATACATT2350.0425.0854823
GGATTCC39300.0423.4660622