FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_20_JM84_5_CGGAAT_L002_R1_001_TRIMMED_prinseq_good_fq0R.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_20_JM84_5_CGGAAT_L002_R1_001_TRIMMED_prinseq_good_fq0R.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20117287
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT11143125.539076914297639No Hit
AACATTCAACGCTGTCGGTGAG8992174.4698721055180055No Hit
AACATTCAACGCTGTCGGTGAGT8640364.294992659795528No Hit
TTCCCTTTGTCATCCTATGCCT7891263.9226263461867394No Hit
TCCTTCATTCCACCGGAGTCTG5809582.887854609818908No Hit
AAGCTGCCAGCTGAAGAACTGT4373842.1741699067075992No Hit
TACCCTGTAGAACCGAATTTGT4097302.0367060429172184No Hit
AACAGTAAGAGTTTATGTGCTG3988981.982861804377499No Hit
TGAGGTAGTAGGTTGTATAGTT2995221.4888786942294954No Hit
TACCCTGTAGAACCGAATTTGC2966401.47455270683368No Hit
TAGCTTATCAGACTGGTGTTGGC2939801.4613302479603736No Hit
TCCTTCATTCCACCGGAGTCTGT2795231.3894666810688738No Hit
CCTGTCTGAGGGTCGCT2688061.3361940901872105No Hit
TACCCTGTAGAACCGAATTTGCG2550411.2677703509424507No Hit
TATTGCACTTGTCCCGGCCTGT2529011.2571327336533997No Hit
AACATTCAACGCTGTCGGTGA2231971.1094786290020122No Hit
TAACGGAACCCATAATGCAGCTG2081191.0345281647570073No Hit
TTCACGTAATCCAGGATAGGCT1753490.8716334364569139No Hit
TTGGTCCCCTTCAACCAGCTGT1505620.748420997324341No Hit
TTCACAGTGGCTAAGTTCTG1493000.7421477856333212No Hit
TTCACAGTGGTTAAGTTCTG1434740.7131876181912601No Hit
TTTGGTCCCCTTCAACCAGCTGT1214760.6038388774788569No Hit
ACAGTAGTCTGCACATTGGTT1195500.594265021918711No Hit
CCTTTCTGAGGGTCGCT1189360.5912129205096095No Hit
CTACGCCTGTCTGAGGGTCGCT1074490.5341127757435682No Hit
TTCACAGTGGCTAAGTTCTGC1073720.5337300203551304No Hit
AAGCTGCCAGCTGAAGAACT1067300.5305387351684151No Hit
ACCCTGTAGAACCGAATTTGCG1049420.521650856797937No Hit
TTCAGTCATTGTTTCTGGTTGT898860.44680975123534306No Hit
TTCAAGTAATCCAGGATAGGTT884990.43991518339426183No Hit
TTCACAGTGGCTAAGTTCAGT859400.42719478029020513No Hit
TTAGGTAGTAGGTTGTATAGTT847760.42140871182083345No Hit
TTCCCTTTGTCATCCTATGCCTG834290.41471297794777195No Hit
CTGTCTGAGGGTCGCT818540.40688389045699846No Hit
TCCTTCATTCCACCGGAGTCT790680.39303510458443025No Hit
TTATGTAGTAGGTTGTATAGTT783820.3896251020328934No Hit
TGATGTAGTAGGTTGTATAGTT722810.35929795106069723No Hit
TTCAAGTAATCCAGGATAGGC720430.3581148889509803No Hit
TTCCATTTGTCATCCTATGCCT712830.35433704355860707No Hit
AAGCTGCCAGCTGAAGAACTGC617140.30677098755910776No Hit
TTCAAGTAATCCAGGATAGGCTT587330.2919528860924438No Hit
CATTGCACTTGTCTCGGTCTGA586800.29168943108481776No Hit
TAGCTTATCAGACTGGTGTTGG576900.28676829037633156No Hit
TTGTTCCCCTTCAACCAGCTGT575250.28594810025825057No Hit
TATTGCACTTGTCCCGGCCTGTT562400.27956055903561944No Hit
TACCCTGTAGATCCGGATTTGT542050.2694448809126201No Hit
TGAGGTAGTAGTTTGTATAGTT534740.26581119014706106No Hit
TGAGGTAGTAGGTTGTATAGT505560.25130625218002806No Hit
ACATTAGTCTGCACATTGGTT481650.23942095174165384No Hit
TACCCTGTAGAACCGAATTTG470230.233744241954693No Hit
TTTTGTCCCCTTCAACCAGCTGT457370.22735172988286143No Hit
TGTCTGAGGGTCGCT455110.22622831796355047No Hit
AACATTCATTGCTGTCGGTGGG448710.22304697447523614No Hit
AACATTCATTGCTGTCGGTGGGT443730.2205714915733916No Hit
TACAGTAGTCTGCACATTGGTT439270.21835449282997257No Hit
TCCAGCATCAGTGATTTTGTT437400.2174249440294807No Hit
TTCACAGTGGTTAAGTTCTGCC429560.2135277982562957No Hit
CCACGTTCCCGTGG420070.20881046236502962No Hit
TTCACAGTGGTTAAGTTCTGC398770.19822255356798357No Hit
ATGACCTATGAATTGACAGCC394100.19590116699135426No Hit
TACCATGTAGAACCGAATTTGT390760.19424090335839023No Hit
TTCCAGTGATGACAGCCTATAATCTGACT389700.19371399334313816No Hit
TGAGGTAGTAGGTTGTATAGTTT386180.1919642544245653No Hit
AACATTCAACGCTGTCGGTGAGA364190.1810333570326854No Hit
TATTGCACTTGTCCCGGCCTGTAT360490.17919414282850366No Hit
TCCAGTGATGACAGCCTATAATCTGACT360400.17914940518569925No Hit
TCCAGCATCAGTGATTTTGTTG359240.17857278667844229No Hit
TATTGCACTTGTCCCGGCCTGTA335020.16653338991485284No Hit
ACAGTAGTCTGCACATTGGTTA332050.16505704770230697No Hit
TATTGCACTTGTCCCGGCCTGTTT323660.16088650522309494No Hit
TTCACAGTGGCTAAGTTCTGCT323090.16060316681866696No Hit
TTCAAGTAATCCAGGATGGGCT308280.15324133915273963No Hit
CACCACGTTCCCGTGG307730.15296794244671263No Hit
ACCCTGTAGAACCGAATTTGC305670.15194394751141146No Hit
TACAGTACTGTGATAACTGAAG301110.1496772402759875No Hit
ATGACCTATGAATTGACAGCCA301070.14965735687918555No Hit
TACCCTGTAGAACCGAATGTGT285570.14195254061842433No Hit
TGAGATGAAGCACTGTAGCTCT271010.13471498418250932No Hit
TACCATGTAGAACCGAATTTGC270870.13464539229370243No Hit
AACATTCAACGCTGTCGGTGG269110.133770522834416No Hit
CATAAAGTAGAAAGCACTACT255230.12687098414413434No Hit
TTTGGTCCCCTTCAACCAGCTG254140.12632916158128082No Hit
TGTAAACATCCTTGACTGGAAGCT249740.12414198793306473No Hit
ACCCTGTAGAACCGAATTTGTG248880.1237144949018225No Hit
TATGTGCCCTTGGACTACATCG247030.12279488779973165No Hit
TGAGGTAGTAGATTGAATAGTT245790.12217850249887074No Hit
TGAAATGTTTAGGACCACTTGT241930.12025975470748118No Hit
TCCCTGAGACCCTTAACCTGTG241680.1201354834774689No Hit
AACACTCAACGCTGTCGGTGAG240280.11943956458940015No Hit
TACCATGTAGAACCGAATTTGCG237070.11784392199604252No Hit
CATTATTACTTTTGGTACGCG235050.11683981045754331No Hit
TTCAGTCATTGTTTCTGGTTGTT234800.11671553922753103No Hit
TGAGATGAAGCACTGTAGCTC232250.1154479726814058No Hit
TTCACAGTGGTTAAGTTCTGCCT231670.11515966342777731No Hit
AACACTCAACGCTGTCGGTGAGT231580.1151149257849729No Hit
TCCCTGAGACCCTTAACCTGTGA227400.11303711081916762No Hit
GTGAAATGTTTAGGACCACTTG220530.10962213741843023No Hit
TTCAGTCATTGTTTCTGGTTGTA218530.108627967578332No Hit
GTGAAATGTTTAGGACCACT213500.10612763043048498No Hit
TTTCTGAGGGTCGCT213500.10612763043048498No Hit
TTCCCTTTGTCATCCTATGCC213370.10606300939087861No Hit
TAACACTGTCTGGTAACGATGT212960.10585920457365845No Hit
GTACAGTACTGTGATAACTGA206980.10288663675176478No Hit
CCCTGAGACCCTTAACCTGTGA205000.10190240861006755No Hit
TTCAGGTAATCCAGGATAGGCT203940.10137549859481548No Hit
GAGAGAGGCATGATCGTAGCGATAACTA203750.10128105246000615No Hit
AACCCGTAGATCCGAACTTGTG202650.10073425904795215No Hit
ACCACGTTCCCGTGG202570.10069449225434822No Hit
AACATTCAACGCTGTCGGTG201700.10026202837390549No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAA4150.01515.799723
GATTCCT8900.01435.698723
AATAACC2000.01425.20723
TAACTGC4450.01369.435723
TCGGATA357.8216544E-111123.315923
ATAACTA29600.0880.3753722
ACAACCC6850.0856.4540422
TCTGACT110050.0849.3768323
TAACACC700.0842.4869423
GGCTCGT2450.0722.1316523
GCTGAGC4650.0697.542923
TAATAAC3050.0656.081422
GGACACT1650.0655.2676423
GGATTCC13300.0639.432822
GACAACC12450.0635.434321
AAATAGC1600.0614.3133523
GTACTCT2200.0580.805423
GATAAAA8000.0573.6445321
ATAAAAA2700.0555.846822
CGATAAA13900.0553.638720