FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_20_JM87_5_CTAGCT_L003_R1_001_TRIMMED_prinseq_good_rPcH.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_20_JM87_5_CTAGCT_L003_R1_001_TRIMMED_prinseq_good_rPcH.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14205983
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT9433576.640561233953328No Hit
AACATTCAACGCTGTCGGTGAG7194045.064091657719145No Hit
TTCCCTTTGTCATCCTATGCCT5760534.055002740746628No Hit
AACATTCAACGCTGTCGGTGAGT5020473.534053222504912No Hit
TACCCTGTAGAACCGAATTTGT4636533.2637868143302717No Hit
TACCCTGTAGAACCGAATTTGC3594322.530145221207149No Hit
TCCTTCATTCCACCGGAGTCTG3049952.1469475220405374No Hit
AAGCTGCCAGCTGAAGAACTGT2844402.0022549653902866No Hit
AACAGTAAGAGTTTATGTGCTG2785021.9604556756121698No Hit
TACCCTGTAGAACCGAATTTGCG2563281.8043665123349788No Hit
TGAGGTAGTAGGTTGTATAGTT2318131.6317983767825148No Hit
TAGCTTATCAGACTGGTGTTGGC2166221.5248645588270802No Hit
TTCACAGTGGTTAAGTTCTG1601271.1271800057764394No Hit
TTCACAGTGGCTAAGTTCTG1287940.9066180073564779No Hit
TTGGTCCCCTTCAACCAGCTGT1209100.8511202639057078No Hit
AACATTCAACGCTGTCGGTGA1190190.8378089710511408No Hit
TATTGCACTTGTCCCGGCCTGT1139280.8019719578715532No Hit
ACCCTGTAGAACCGAATTTGCG1081850.7615453291757424No Hit
TCCTTCATTCCACCGGAGTCTGT1059100.7455309498821729No Hit
CCTGTCTGAGGGTCGCT1056080.743405085026499No Hit
TTCACGTAATCCAGGATAGGCT1033700.7276511593741877No Hit
TAACGGAACCCATAATGCAGCTG1030790.7256027266821311No Hit
TTTGGTCCCCTTCAACCAGCTGT904550.636738759999924No Hit
AAGCTGCCAGCTGAAGAACT833240.5865416001131355No Hit
TTCAAGTAATCCAGGATAGGC679780.4785166925794575No Hit
ATGACCTATGAATTGACAGCC654550.46075656996069897No Hit
ACAGTAGTCTGCACATTGGTT632060.44492521214477027No Hit
TTCACAGTGGCTAAGTTCTGC582170.4098062063005425No Hit
TTCAAGTAATCCAGGATAGGTT545110.3837186064491278No Hit
TGAGGTAGTAGGTTGTATAGT482380.33956115532448544No Hit
TACCCTGTAGAACCGAATGTGT475710.33486595049423895No Hit
TTCAGTCATTGTTTCTGGTTGT470770.33138854241906385No Hit
TCCAGCATCAGTGATTTTGTT427710.3010773700067077No Hit
TCCTTCATTCCACCGGAGTCT427010.30058461987459795No Hit
AAGCTGCCAGCTGAAGAACTGC424780.299014858739448No Hit
TACCCTGTAGAACCGAATTTG417260.29372131446306815No Hit
CATTGCACTTGTCTCGGTCTGA409590.2883221808726647No Hit
ATGACCTATGAATTGACAGCCA406170.2859147445129281No Hit
ACCCTGTAGAACCGAATTTGC402690.2834650724275821No Hit
TTCCATTTGTCATCCTATGCCT384310.27052686181589825No Hit
TGAGGTAGTAGTTTGTATAGTT373720.2630722562458367No Hit
TTCACAGTGGCTAAGTTCAGT362560.25521641128248573No Hit
TTCAAGTAATCCAGGATAGGCTT353550.24887401315347202No Hit
AACATTCATTGCTGTCGGTGGG325660.2292414400326961No Hit
TGAGGTAGTAGGTTGTATAGTTT323700.22786173966278855No Hit
TACCATGTAGAACCGAATTTGT312510.21998477683663284No Hit
TGATGTAGTAGGTTGTATAGTT312090.21968912675736696No Hit
TACCCTGTAGATCCGGATTTGT308920.21745767258766957No Hit
TATTGCACTTGTCCCGGCCTGTT300940.21184032108161754No Hit
TGAGATGAAGCACTGTAGCTCT295010.20766602353388708No Hit
TTTGGTCCCCTTCAACCAGCTG292760.20608218382353405No Hit
TTCACAGTGGTTAAGTTCTGCC292640.20599771237231526No Hit
TAGCTTATCAGACTGGTGTTGG290950.2048080727676501No Hit
TTCCCTTTGTCATCCTATGCCTG284930.20057042163150554No Hit
TTCCAGTGATGACAGCCTATAATCTGACT272240.19163756566511447No Hit
TGAGATGAAGCACTGTAGCTC271300.190975872630567No Hit
TATTGCACTTGTCCCGGCCTGTA260470.18335232415806776No Hit
TCCAGCATCAGTGATTTTGTTG259510.18267655254831713No Hit
TGGACGGAGAACTGATAAGGGC259000.18231754888063711No Hit
ACCCTGTAGAACCGAATTTGTG254240.1789668479822903No Hit
AACATTCATTGCTGTCGGTGGGT246530.17353955724148057No Hit
TACCATGTAGAACCGAATTTGC243360.1713081030717832No Hit
TTCACAGTGGCTAAGTTCTGCT233890.16464189771309734No Hit
TTCACAGTGGTTAAGTTCTGC233020.16402947969176085No Hit
CATTATTACTTTTGGTACGCG231580.1630158222771349No Hit
TATGTGCCCTTGGACTACATCG227740.1603127358381324No Hit
TGAGATGAAGCACTGTAGCT226790.15964400351598337No Hit
GAGAGAGGCATGATCGTAGCGATAACTA226510.15944690346313944No Hit
TATTGCACTTGTCCCGGCCTGTAT225510.15874297470298254No Hit
TGAAATGTTTAGGACCACTTGT222630.15671565987373065No Hit
TTCACAGTGGTTAAGTTCTGCCT220650.15532188092862No Hit
AACATTCAACGCTGTCGGTGAGA219900.1547939343585023No Hit
TGTAAACATCCTTGACTGGAAGCT210370.14808549327420706No Hit
TTCAAGTAATCCAGGATGGGCT208910.147057757284378No Hit
ACCCTGTAGAACCGAATTTGT208120.14650165356385406No Hit
TGTAAACATCCCCGACTGGA207870.14632567137381483No Hit
TCCAGTGATGACAGCCTATAATCTGACT206700.14550207472443125No Hit
CTACGCCTGTCTGAGGGTCGCT201770.14203170593685774No Hit
TGAGAACTGAATTCCATAGATGG200270.14097581279662239No Hit
ACAGTAGTCTGCACATTGGTTA197810.1392441480466364No Hit
CTGTCTGAGGGTCGCT185980.13091667081398028No Hit
CACCACGTTCCCGTGG185590.13064213859751908No Hit
TGTAAACATCCTACACTCTCAGCT178990.12599620878048357No Hit
TTGTTCCCCTTCAACCAGCTGT178250.12547530149796743No Hit
CCACGTTCCCGTGG177420.12489104062703721No Hit
TACAGTAGTCTGCACATTGGTT176830.12447572265854463No Hit
CCTTTCTGAGGGTCGCT171590.12078713595532248No Hit
TACCATGTAGAACCGAATTTGCG167650.1180136566403043No Hit
AACATTCAACGCTGTCGGTGG166580.11726045286693643No Hit
TACCCTGTAGAACCGAATTTGTG163540.11512050943605943No Hit
TACAGTACTGTGATAACTGAAG157000.11051681534463333No Hit
TTAGGTAGTAGGTTGTATAGTT155380.10937645075317914No Hit
TTCAAGTAATCCAGGATAGGCA153130.1077926110428261No Hit
AACATTCAACGCTGTCGGTGT150490.10593423911601188No Hit
AACCCGTAGATCCGAACTTGTG150410.10587792481519935No Hit
TGAGGTAGTAGATTGAATAGTT147300.10368870637111138No Hit
TTTGGTCCCCTTCAACCAGCT142550.10034504476036611No Hit
GTGAAATGTTTAGGACCACTTG142450.1002746518843504No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTATATC50.0065122151121.106723
GGGCACG50.0065122151121.106723
TAACTAA1800.0965.3974623
CAACCCG11700.0934.2555523
TAACTGC3550.0900.043423
GATTCCT7250.0896.885323
AATAACC1550.0795.624123
TCTGACT63000.0544.537523
ATAACTA28450.0528.5445622
ACAACCC16700.0481.510622
AAATAGC1700.0461.6321723
GATGCTT655.4569682E-11431.194923
TAAAAAA1050.0427.0882623
TCTGAGA15100.0426.9114723
GGATTCC13000.0385.566522
ATAAAAA2200.0377.6939722
GCTGAGC2500.0358.7541523
GACAACC24500.0357.997821
TAATAAC2250.0345.4749522
GATAAAA5250.0343.081221