FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_20_JM88_5_CTATAC_L004_R1_001_TRIMMED_prinseq_good_C_Qq.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_20_JM88_5_CTATAC_L004_R1_001_TRIMMED_prinseq_good_C_Qq.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8926381
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT6362597.12784946105258No Hit
AACATTCAACGCTGTCGGTGAG6201256.947104319208424No Hit
AACATTCAACGCTGTCGGTGAGT5242315.872827969140014No Hit
TTCCCTTTGTCATCCTATGCCT4042074.528229301438063No Hit
TACCCTGTAGAACCGAATTTGT2562012.8701553294666673No Hit
TCCTTCATTCCACCGGAGTCTG2475542.773285164502837No Hit
AAGCTGCCAGCTGAAGAACTGT2164022.424297147970717No Hit
TAGCTTATCAGACTGGTGTTGGC2096302.3484321361590994No Hit
TACCCTGTAGAACCGAATTTGC1645811.8437595258369546No Hit
TACCCTGTAGAACCGAATTTGCG1328281.4880386575477789No Hit
AACAGTAAGAGTTTATGTGCTG1308471.4658460130706947No Hit
TGAGGTAGTAGGTTGTATAGTT1176541.3180481541175535No Hit
AACATTCAACGCTGTCGGTGA1099141.23133888190522No Hit
TCCTTCATTCCACCGGAGTCTGT1094071.2256590884928618No Hit
TTCACAGTGGCTAAGTTCTG789960.8849723084864964No Hit
TATTGCACTTGTCCCGGCCTGT766940.8591835817897533No Hit
TTCACAGTGGTTAAGTTCTG763570.855408255596529No Hit
CCTGTCTGAGGGTCGCT750980.84130399542659No Hit
TAACGGAACCCATAATGCAGCTG604450.6771501238855926No Hit
TTGGTCCCCTTCAACCAGCTGT560500.6279140448968064No Hit
AAGCTGCCAGCTGAAGAACT559860.6271970690025442No Hit
ACCCTGTAGAACCGAATTTGCG515020.5769639454107998No Hit
ACAGTAGTCTGCACATTGGTT485010.5433444976189118No Hit
TTCAAGTAATCCAGGATAGGC462750.5184071797966051No Hit
TTCCCTTTGTCATCCTATGCCTG435950.4883838142243761No Hit
TTCACAGTGGCTAAGTTCTGC408660.45781151398310244No Hit
TTTGGTCCCCTTCAACCAGCTGT390330.43727687626149947No Hit
TTCAAGTAATCCAGGATAGGTT369990.4144904861219793No Hit
AAGCTGCCAGCTGAAGAACTGC348740.39068464588280516No Hit
TTCACAGTGGCTAAGTTCAGT309990.3472739960348992No Hit
TTCAAGTAATCCAGGATAGGCTT279210.31279193662022714No Hit
TCCTTCATTCCACCGGAGTCT278580.31208616347431284No Hit
AACATTCATTGCTGTCGGTGGG275360.30847887850630623No Hit
AACATTCATTGCTGTCGGTGGGT262470.2940385358859318No Hit
TTCACGTAATCCAGGATAGGCT254770.2854124196580899No Hit
TTAGGTAGTAGGTTGTATAGTT234610.26282767898883097No Hit
CACCACGTTCCCGTGG233780.2618978508759597No Hit
CATTGCACTTGTCTCGGTCTGA231660.2595228682262162No Hit
TTCCAGTGATGACAGCCTATAATCTGACT227650.2550305661387297No Hit
TTCACAGTGGTTAAGTTCTGCC224770.25180417461454985No Hit
TACCCTGTAGAACCGAATTTG224510.2515129031575058No Hit
TTCAGTCATTGTTTCTGGTTGT213790.2395035569286142No Hit
TACCCTGTAGATCCGGATTTGT203440.2279087123885929No Hit
AACATTCAACGCTGTCGGTGG202490.22684445129554742No Hit
AACATTAAGAGTTTATGTGCTG191960.21504795728526488No Hit
TATTGCACTTGTCCCGGCCTGTT190460.21336754503308789No Hit
TAGCTTATCAGACTGGTGTTGG189440.2122248647016075No Hit
AACATTCAACGCTGTCGGTGAGA187510.21006273427047312No Hit
TGAGGTAGTAGGTTGTATAGT187360.2098946930452554No Hit
TATGTGCCCTTGGACTACATCG182690.204663009566811No Hit
TTCACAGTGGCTAAGTTCTGCT176000.19716837092210157No Hit
TATTGCACTTGTCCCGGCCTGTAT163050.18266081181164012No Hit
ACCCTGTAGAACCGAATTTGC162560.18211187714259564No Hit
ACCCTGTAGAACCGAATTTGTG158960.17807888773737082No Hit
TACCCTGTAGAACCGAATGTGT158160.1771826678695431No Hit
TGAGGTAGTAGTTTGTATAGTT157580.17653290846536798No Hit
TGAGGTAGTAGGTTGTATAGTTT156930.17580472982275797No Hit
TTCACAGTGGTTAAGTTCTGC152700.17106596727161882No Hit
ACAGTAGTCTGCACATTGGTTA149530.1675146960453514No Hit
TTCACAGTGGTTAAGTTCTGCCT147800.16557662058117392No Hit
TATTGCACTTGTCCCGGCCTGTA143740.16102830475194818No Hit
AACCCGTAGATCCGAACTTGTG143680.16096108826186112No Hit
CTGTCTGAGGGTCGCT142790.15996404365890277No Hit
TGAGATGAAGCACTGTAGCTC141430.1584404698835956No Hit
TCCAGCATCAGTGATTTTGTT138620.1552924975978507No Hit
TGAGATGAAGCACTGTAGCTCT137180.15367930183576076No Hit
TCCAGTGATGACAGCCTATAATCTGACT132980.14897414752966515No Hit
TCCCTGAGACCCTTAACCTGTGA132610.14855964584079484No Hit
CATTATTACTTTTGGTACGCG123490.13834273934755864No Hit
CTACGCCTGTCTGAGGGTCGCT123150.13796184590373187No Hit
TTTAAGTAATCCAGGATAGGCT121890.13655029961190318No Hit
TACAGTAGTCTGCACATTGGTT121600.13622541990981563No Hit
AATATTCAACGCTGTCGGTGAG120920.13546363302216208No Hit
TGGACGGAGAACTGATAAGGGC119840.13425373620059464No Hit
CTGGACAACTCTTAGCGG117230.13132981888180661No Hit
TGTAAACATCCTTGACTGGAAGCT117120.13120658864998033No Hit
TCCCTGAGACCCTTAACCTGTG112710.12626617662857995No Hit
TTCAAGTAATCCAGGATGGGCT111050.12440652040283738No Hit
TACCCTGTAGAACCGAATTTGTG109590.12277091914405178No Hit
ACCACGTTCCCGTGG106770.119611744109959No Hit
AACATTCAACGCTGTCGGTGT105670.11837944179169588No Hit
TGTAAACATCCTACACTCTCAGCT104700.11729277520195473No Hit
TGAGGTAGTAGATTGAATAGTT104000.11650858281760548No Hit
TATTGCACTTGTCCCGGCCTGTTT103370.11580280967169114No Hit
AATATTCAACGCTGTCGGTGAGT102420.1147385485786457No Hit
ACCCTGTAGAACCGAATTTGT99780.11178102301481417No Hit
TTCCCTTTGTCATCCTATGCC99240.11117607460403046No Hit
TTTCCTTTGTCATCCTATGCCT98750.11062713993498596No Hit
TCCAGCATCAGTGATTTTGTTG98640.11050390970315967No Hit
TTTGGTCCCCTTCAACCAGCTG97280.1089803359278525No Hit
TTCCATTTGTCATCCTATGCCT96870.10852102324559079No Hit
AACATTCAACGCTGTCGGTG96260.10783765559637215No Hit
CTTTCAGTCGGATGTTTGCAGC95910.1074455594041975No Hit
CCACGTTCCCGTGG91180.10214665943566605No Hit
TGAGATGAAGCACTGTAGCT90000.10082473513062012No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATCGTGT50.00304656991638.98623
AAGCAAC50.00304656991638.98623
CAACCCG3850.01468.701923
TAACTGC1750.01404.845223
TAACTAA750.01311.18923
AATAACC750.01092.657523
GCTGAGC1000.0983.3916623
GATTCCT2100.0936.563523
TCTGACT47600.0859.090423
AAATAGC850.0771.287623
ATAACTA9500.0758.73222
ACAACCC7050.0726.298522
TAACACC352.2558379E-7702.422623
TAACACA257.7215656E-5655.594423
TAATAAC1050.0600.193922
GGACACT1000.0573.6451423
GACAACC10700.0568.143321
GCTTCCA150.0010957461546.328723
GATAAAA2900.0500.5977221
GAGTATC101.837817E-4491.0979320