FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_20_JM91_5_CTCAGA_L005_R1_001_TRIMMED_prinseq_good_pmgc.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_20_JM91_5_CTCAGA_L005_R1_001_TRIMMED_prinseq_good_pmgc.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18884143
Sequences flagged as poor quality0
Sequence length12-29
%GC49

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCCCTTTGTCATCCTATGCCT9034044.783929035063969No Hit
TTCAAGTAATCCAGGATAGGCT8759264.638420710963691No Hit
TCCTTCATTCCACCGGAGTCTG5798013.070306129327659No Hit
AACATTCAACGCTGTCGGTGAG5178232.742104844260076No Hit
AACATTCAACGCTGTCGGTGAGT5112732.707419658917008No Hit
TGAGGTAGTAGGTTGTATAGTT4455012.359127443591165No Hit
TACCCTGTAGAACCGAATTTGT4001902.1191853927392943No Hit
CCTGTCTGAGGGTCGCT3783342.003448078104471No Hit
TAGCTTATCAGACTGGTGTTGGC3764471.993455567456781No Hit
TAACGGAACCCATAATGCAGCTG3246861.7193578760762402No Hit
AAGCTGCCAGCTGAAGAACTGT3058501.6196128148362359No Hit
AACAGTAAGAGTTTATGTGCTG2574791.3634666926637866No Hit
TCCTTCATTCCACCGGAGTCTGT2310321.2234179755999517No Hit
TACCCTGTAGAACCGAATTTGC2309211.22283018085597No Hit
TATTGCACTTGTCCCGGCCTGT2146041.1364243534906509No Hit
TACCCTGTAGAACCGAATTTGCG1892251.0020311750445865No Hit
TTGGTCCCCTTCAACCAGCTGT1657270.8775987345573478No Hit
TTTGGTCCCCTTCAACCAGCTGT1436650.7607705576048646No Hit
AACATTCAACGCTGTCGGTGA1210990.6412734747878154No Hit
ACAGTAGTCTGCACATTGGTT1165050.6169461860143719No Hit
CTACGCCTGTCTGAGGGTCGCT1082550.5732587388265382No Hit
TTCACAGTGGCTAAGTTCTG1058240.5603855043885232No Hit
CTGTCTGAGGGTCGCT973500.5155118768164381No Hit
TTCACAGTGGTTAAGTTCTG844450.4471741185183781No Hit
TTCACAGTGGCTAAGTTCTGC787770.4171595184383003No Hit
TGAGGTAGTAGTTTGTATAGTT772530.4090892554668751No Hit
ACCCTGTAGAACCGAATTTGCG758520.40167033261715934No Hit
TGTCTGAGGGTCGCT711440.3767393627553022No Hit
AAGCTGCCAGCTGAAGAACT699890.3706231201490054No Hit
TTCAAGTAATCCAGGATAGGTT687440.3640302872097505No Hit
TGAGGTAGTAGGTTGTATAGT669960.35477384385407373No Hit
TTCCCTTTGTCATCCTATGCCTG669370.3544614124135789No Hit
TCCTTCATTCCACCGGAGTCT649680.3440346750180826No Hit
TTCACAGTGGCTAAGTTCAGT571240.3024971797767047No Hit
CCTTTCTGAGGGTCGCT570160.30192527137715486No Hit
TTCAAGTAATCCAGGATAGGC567490.30051138672271227No Hit
AAGCTGCCAGCTGAAGAACTGC515850.27316569250720035No Hit
TGAGGTAGTAGGTTGTATAGTTT512360.2713175811049514No Hit
TAGCTTATCAGACTGGTGTTGG453730.24027036863679754No Hit
TATTGCACTTGTCCCGGCCTGTT423770.2244052059974339No Hit
TACCCTGTAGAACCGAATGTGT421170.2230283894799992No Hit
TTCAAGTAATCCAGGATAGGCTT419420.2221016860548027No Hit
CATTGCACTTGTCTCGGTCTGA418480.2216039139292686No Hit
TGAGATGAAGCACTGTAGCTC411080.2176852823027235No Hit
TACCCTGTAGAACCGAATTTG395050.20919667892792382No Hit
CCACGTTCCCGTGG386920.20489147958686818No Hit
TGAGATGAAGCACTGTAGCTCT380610.20155005180801688No Hit
CACCACGTTCCCGTGG369450.1956403316793354No Hit
TTTGGTCCCCTTCAACCAGCTG359730.190493156083387No Hit
ACAGTAGTCTGCACATTGGTTA351990.1863944792199466No Hit
TGAGGTAGTAGATTGAATAGTT332590.17612130982062568No Hit
TTCACAGTGGTTAAGTTCTGCC329700.17459092530701553No Hit
TGGACGGAGAACTGATAAGGGC328760.1740931531814814No Hit
TGTAAACATCCTACACTCTCAGCT321280.17013215796978448No Hit
TTCAGTCATTGTTTCTGGTTGT319440.1691577955112922No Hit
TTCCAGTGATGACAGCCTATAATCTGACT318070.16843231911556697No Hit
AATGACACGTTTTCTCCCGGATT316440.16756916106809824No Hit
TCCAGCATCAGTGATTTTGTT310170.16424891508182288No Hit
TACAGTAGTCTGCACATTGGTT296290.15689883305797886No Hit
TGTAAACATCCTTGACTGGAAGCT291560.1543940860858764No Hit
GTCTTTGCTGCGAGCC287040.1520005435247975No Hit
AACATTCATTGCTGTCGGTGGG270080.14301946347260766No Hit
AACATTCATTGCTGTCGGTGGGT263070.1393073543236778No Hit
TTCACAGTGGTTAAGTTCTGC258310.1367867210071434No Hit
CTGTCGACCGGA258120.13668610749240778No Hit
TACCCTGTAGATCCGGATTTGT257860.1365484258406643No Hit
TATTGCACTTGTCCCGGCCTGTAT257710.1364689941185046No Hit
TTCAAGTAATCCAGGATGGGCT254340.1346844280939834No Hit
TCCAGCATCAGTGATTTTGTTG249490.13211613574415318No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT249010.13186195423324215No Hit
TGAGAACTGAATTCCATAGATGG247620.13112588694122893No Hit
TTCACAGTGGCTAAGTTCTGCT244470.12945782077587528No Hit
CATTATTACTTTTGGTACGCG242960.12865820810613432No Hit
TATTGCACTTGTCCCGGCCTGTA242560.12844639018037515No Hit
TCCAGTGATGACAGCCTATAATCTGACT237230.1256239163196339No Hit
TATGTGCCCTTGGACTACATCG226350.1198624687389838No Hit
TATTGCACTTGTCCCGGCCTGTTT225740.11953944640220104No Hit
TTGTTCCCCTTCAACCAGCTGT225220.11926408309871409No Hit
TGAGGTAGTTGGTTGTATAGTT224030.11863392476958048No Hit
ACCCTGTAGAACCGAATTTGC222930.1180514254737427No Hit
TTCCCTTTGTCATCCTATGCC221690.1173947899038892No Hit
TACGACCTCAGATCAGACGAGA216130.1144505207358364No Hit
ACCCTGTAGAACCGAATTTGTG215480.11410631660647773No Hit
ACCACGTTCCCGTGG214570.11362443082537557No Hit
TACGCCTGTCTGAGGGTCGCT214390.11352911275878393No Hit
AATGACACGTTTTCTCCCGGATTG206010.1090915272141288No Hit
CACGTTCCCGTGG200230.10603075818690845No Hit
AACCCGTAGATCCGAACTTGTG199800.10580305391671734No Hit
TCCCTGAGACCCTTAACCTGTG199130.10544825889107066No Hit
GAAGGATCATTA193200.10230805814169061No Hit
TGTAAACATCCCCGACTGGAAGCT191220.10125955940918262No Hit
TCCCTGAGACCCTTAACCTGTGA188900.10003101543977928No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GATTCCT31650.0721.1556423
CAACCCG23500.0700.7815623
TAACTAA2300.0699.865223
AGTATTT303.6379788E-12687.901723
TAACTGC3400.0679.808723
AATAACC1500.0605.3534523
GCACGCC302.748493E-9550.321323
CATAGCT2750.0510.2979423
GCTTCCT1400.0471.70423
ATAACTA20650.0402.6941522
ACAACCC40400.0372.556922
TAACACA353.5031298E-6353.77823
ATCACTA1550.0348.7201522
TCTGACT84450.0337.7193623
TAATAAC1950.0309.1710222
GCATAGC5750.0303.7014522
GAGTATT355.0931703E-10296.986922
GGATTCC43650.0290.9995722
AAATAGC1200.0275.1606423
GACAACC62750.0260.8765321