FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_27_JM55_5_GACGAC_L001_R1_001_TRIMMED_prinseq_good_Zyfx.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_27_JM55_5_GACGAC_L001_R1_001_TRIMMED_prinseq_good_Zyfx.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14534573
Sequences flagged as poor quality0
Sequence length12-29
%GC47

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT8081755.560362867213231No Hit
TCCTTCATTCCACCGGAGTCTG4688993.2260940861489362No Hit
TTCCCTTTGTCATCCTATGCCT4062622.7951423134343196No Hit
AACATTCAACGCTGTCGGTGAGT3714122.555369187660346No Hit
TAGCTTATCAGACTGGTGTTGGC3331642.2922173221050253No Hit
AACATTCAACGCTGTCGGTGAG3312592.2791106419156586No Hit
TACCCTGTAGAACCGAATTTGT2959392.0361038470136No Hit
AAGCTGCCAGCTGAAGAACTGT2919212.008459416042012No Hit
TCCTTCATTCCACCGGAGTCTGT2521121.7345676408932No Hit
TAACGGAACCCATAATGCAGCTG2410081.6581704877054178No Hit
TACCCTGTAGAACCGAATTTGC2020371.3900442758105105No Hit
CCTGTCTGAGGGTCGCT2005301.379675894159395No Hit
AACAGTAAGAGTTTATGTGCTG1972811.357322296293121No Hit
TATTGCACTTGTCCCGGCCTGT1585971.09117068661047No Hit
TACCCTGTAGAACCGAATTTGCG1410570.9704929068091647No Hit
TTGGTCCCCTTCAACCAGCTGT1409050.9694471244528478No Hit
TGAGGTAGTAGGTTGTATAGTT1277210.8787392653365187No Hit
TTCACGTAATCCAGGATAGGCT1251900.861325613074426No Hit
TTTGGTCCCCTTCAACCAGCTGT1102060.758233489212239No Hit
AACATTCAACGCTGTCGGTGA990560.6815198492587295No Hit
TTCACAGTGGCTAAGTTCTG971140.6681586036273649No Hit
CCTTTCTGAGGGTCGCT923010.6350444557263567No Hit
CTACGCCTGTCTGAGGGTCGCT856300.5891469945487906No Hit
CTGTCTGAGGGTCGCT847030.5827690982046738No Hit
TTCACAGTGGTTAAGTTCTG846550.5824388511447842No Hit
AAGCTGCCAGCTGAAGAACT768960.5290557899430551No Hit
TTCAAGTAATCCAGGATAGGTT691180.47554200594678636No Hit
TTCACAGTGGCTAAGTTCTGC662830.45603678897205996No Hit
ACAGTAGTCTGCACATTGGTT640010.44033629333314434No Hit
TTGTTCCCCTTCAACCAGCTGT637940.43891210288737065No Hit
ACCCTGTAGAACCGAATTTGCG635980.43756359405948836No Hit
CCACGTTCCCGTGG534020.3674136144212837No Hit
TCCTTCATTCCACCGGAGTCT492580.33890228491748603No Hit
TTCAAGTAATCCAGGATAGGC487200.3352007657878907No Hit
TTCAAGTAATCCAGGATAGGCTT482680.33209093930726413No Hit
TTCACAGTGGCTAAGTTCAGT479420.3298480113588476No Hit
TTCAAGTAATCCAGGATGGGCT470350.32360771795635135No Hit
TTAGGTAGTAGGTTGTATAGTT469690.32315362824900323No Hit
TGTCTGAGGGTCGCT448110.3083062708481357No Hit
AAGCTGCCAGCTGAAGAACTGC447350.30778337966997726No Hit
TTCCATTTGTCATCCTATGCCT446770.3073843311392774No Hit
TAGCTTATCAGACTGGTGTTGG443640.30523084510291426No Hit
TTTTGTCCCCTTCAACCAGCTGT410540.28245755826469754No Hit
TACCCTGTAGAACCGAATTTG401140.27599022000852724No Hit
ATGACCTATGAATTGACAGCC400660.2756599729486377No Hit
TGATGTAGTAGGTTGTATAGTT399070.2745660295627536No Hit
TCCAGCATCAGTGATTTTGTT374460.2576339875963332No Hit
TATTGCACTTGTCCCGGCCTGTT356680.2454010860862579No Hit
CACCACGTTCCCGTGG355460.244561708142372No Hit
CATTGCACTTGTCTCGGTCTGA339270.23342275001818077No Hit
TTCCAGTGATGACAGCCTATAATCTGACT331380.22799431397124634No Hit
TATTGCACTTGTCCCGGCCTGTAT327220.22513217278553693No Hit
TTCAGTCATTGTTTCTGGTTGT315710.21721312349526883No Hit
TACCATGTAGAACCGAATTTGT314970.21670399261127246No Hit
TTCCCTTTGTCATCCTATGCCTG314100.21610541981522263No Hit
TCCAGTGATGACAGCCTATAATCTGACT305800.2103948977379659No Hit
ACATTAGTCTGCACATTGGTT300830.20697546463869285No Hit
TGAGGTAGTAGTTTGTATAGTT296480.20398260065844384No Hit
ATGACCTATGAATTGACAGCCA284080.19545121827796386No Hit
TACCCTGTAGAACCGAATGTGT278050.19130248958810142No Hit
ACCCTGTAGAACCGAATTTGC270820.1863281432485151No Hit
TTATGTAGTAGGTTGTATAGTT264740.1821450138232475No Hit
TGAGGTAGTAGGTTGTATAGT259790.17873934101813654No Hit
TATTGCACTTGTCCCGGCCTGTA247290.17013915716684624No Hit
ACCACGTTCCCGTGG245640.16900393289847593No Hit
TCCAGCATCAGTGATTTTGTTG242490.16683668656795078No Hit
TTCACAGTGGTTAAGTTCTGCC239740.16494464612066692No Hit
TATTGCACTTGTCCCGGCCTGTTT226010.15549820417840965No Hit
TTCACAGTGGTTAAGTTCTGC224140.15421161667425662No Hit
TTCAGGTAATCCAGGATAGGCT219240.1508403446045508No Hit
TACCATGTAGAACCGAATTTGC218860.15057889901547158No Hit
TTCACAGTGGCTAAGTTCTGCT214910.14786124091846387No Hit
TTTGGTCCCCTTCAACCAGCTG213880.14715258576911755No Hit
TTTCTGAGGGTCGCT213880.14715258576911755No Hit
AACATTCAACGCTGTCGGTGAGA209700.14427668428924606No Hit
CATTATTACTTTTGGTACGCG208770.14363683061071006No Hit
TAACTGAACCCATAATGCAGCTG204290.14055452471840763No Hit
ACAGTAGTCTGCACATTGGTTA194790.134018384991427No Hit
TACCCTGTAGATCCGGATTTGT190030.13074343498085564No Hit
TATTGCACTTGTCCCGGCCTGTAA188920.12997973865486107No Hit
TGAGGTAGTAGGTTGTATAGTTT182650.12566588643505386No Hit
GAAGGATCATTA178240.12263174157231864No Hit
AACATTCATTGCTGTCGGTGGGT177190.12190932612881025No Hit
TGAGATGAAGCACTGTAGCTCT172400.1186137356769958No Hit
TACAGTAGTCTGCACATTGGTT171350.11789132023348743No Hit
AACATTAAGAGTTTATGTGCTG168160.11569655331463814No Hit
AATGACACGTTTTCTCCCGGATT165580.11392147536773183No Hit
TACAGTACTGTGATAACTGAAG158960.10936681800008848No Hit
TGAGAACTGAATTCCATAGATGG158230.10886456726317312No Hit
ACCCTGTAGAACCGAATTTGT154690.10642899519648771No Hit
AACATTCATTGCTGTCGGTGGG152050.1046126363670952No Hit
TTCAAGTAATCCAGGATAGGCA148230.10198442018214088No Hit
TCCGTCATTCCACCGGAGTCTG147450.10144776870982038No Hit
AACATTCAACGCTGTCGGTGG146960.1011106415028498No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GATTCCT15700.01314.33423
AATAACC2400.01146.391423
TAACTGC3800.0824.597323
TCGGATA301.612425E-7764.2608623
ATAACTA15700.0690.543922
TAACTAA1000.0687.8348423
GGATTCC19850.0627.556722
AAATAGC1000.0611.4087523
TCTGACT104150.0598.053423
ACAACCC4600.0538.4870622
GCTGAGC5400.0509.5072623
TAATAAC3050.0494.348822
GTACTCT3250.0470.3144223
GGCTCGT1300.0470.3144223
GTTCAAG3750.0468.746723
GATAAAA6800.0435.447921
CGATAAA17400.0427.8111320
CGATAAC44200.0424.2461220
GCATAGC1650.0413.38422
GATAACA5050.0412.0267321