FastQCFastQC Report
Tue 7 Jun 2016
nfu_skin_mzm_27_JM62_5_TAATCG_L002_R1_001_TRIMMED_prinseq_good_7YgX.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_27_JM62_5_TAATCG_L002_R1_001_TRIMMED_prinseq_good_7YgX.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences8598497
Sequences flagged as poor quality0
Sequence length12-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT5067285.893215988794321No Hit
AACATTCAACGCTGTCGGTGAG5045195.8675254524133695No Hit
TACCCTGTAGAACCGAATTTGT4982495.794605731676129No Hit
TTCCCTTTGTCATCCTATGCCT3520144.093901527208767No Hit
AACATTCAACGCTGTCGGTGAGT3118263.6265175181197367No Hit
TAGCTTATCAGACTGGTGTTGGC2941393.4208187779794534No Hit
TACCCTGTAGAACCGAATTTGC2896913.3690888070322056No Hit
TACCCTGTAGAACCGAATTTGCG2025152.355237200175798No Hit
TCCTTCATTCCACCGGAGTCTG1592991.8526377342458804No Hit
AACAGTAAGAGTTTATGTGCTG1475061.7154858575865062No Hit
AAGCTGCCAGCTGAAGAACTGT1357901.5792294862695189No Hit
TTCACAGTGGTTAAGTTCTG1229671.4300987719132774No Hit
TTCACAGTGGCTAAGTTCTG1094621.273036438810178No Hit
TAACGGAACCCATAATGCAGCTG1085061.2619182166371634No Hit
ACCCTGTAGAACCGAATTTGCG916121.0654420185295175No Hit
TATTGCACTTGTCCCGGCCTGT823450.9576673690762467No Hit
AACATTCAACGCTGTCGGTGA820390.954108607585721No Hit
TGAGGTAGTAGGTTGTATAGTT757890.8814214856387111No Hit
TTCACGTAATCCAGGATAGGCT712380.8284936309217762No Hit
TTGGTCCCCTTCAACCAGCTGT583620.678746529771424No Hit
TTTGGTCCCCTTCAACCAGCTGT543080.6315987549917154No Hit
TCCTTCATTCCACCGGAGTCTGT518920.6035008211318792No Hit
TACCATGTAGAACCGAATTTGT448130.5211724793298177No Hit
AAGCTGCCAGCTGAAGAACT410150.47700196906505865No Hit
TACCCTGTAGAACCGAATGTGT376300.43763462381855806No Hit
ACCCTGTAGAACCGAATTTGC372010.4326453797681153No Hit
TTCAAGTAATCCAGGATAGGC364930.42441138259395794No Hit
TTCACAGTGGCTAAGTTCTGC348890.4057569596174773No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCG330390.38424157152116234No Hit
TACCCTGTAGAACCGAATTTG324260.37711241860059963No Hit
AAGCTGCCAGCTGAAGAACTGC311270.36200512717513306No Hit
TTCCATTTGTCATCCTATGCCT306890.35691121366908657No Hit
TCCAGCATCAGTGATTTTGTT298220.34682805611259737No Hit
CATTGCACTTGTCTCGGTCTGA283180.32933662708726885No Hit
TAGCTTATCAGACTGGTGTTGG266080.3094494305225669No Hit
TACCCTGTAGATCCGGATTTGT264020.3070536629831934No Hit
TACCATGTAGAACCGAATTTGC255430.2970635449427964No Hit
ACAGTAGTCTGCACATTGGTT254270.2957144719594599No Hit
TTCAAGTAATCCAGGATAGGTT247960.2883759801276898No Hit
TTCCAGTGATGACAGCCTATAATCTGACT246050.28615466168098913No Hit
TTCAAGTAATCCAGGATGGGCT243260.2829099085572746No Hit
TATTGCACTTGTCCCGGCCTGTT228660.26593019687045305No Hit
ACCCTGTAGAACCGAATTTGT224440.26102236239659093No Hit
TTGTTCCCCTTCAACCAGCTGT218370.25396298911309734No Hit
TCCAGTGATGACAGCCTATAATCTGACT205190.23863472883691186No Hit
ACCCTGTAGAACCGAATTTGTG204900.23829746059107773No Hit
TTTTGTCCCCTTCAACCAGCTGT203700.23690186784969514No Hit
TTAGGTAGTAGGTTGTATAGTT202050.23498292783029404No Hit
AACATTCATTGCTGTCGGTGGG201280.2340874224879069No Hit
TCCTTCATTCCACCGGAGTCT189350.22021290465066165No Hit
CATTATTACTTTTGGTACGCG187900.218526563421491No Hit
TTATGTAGTAGGTTGTATAGTT187440.217991586203961No Hit
TACCATGTAGAACCGAATTTGCG185460.21568885818067973No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCT184470.21453749416903908No Hit
CCTGTCTGAGGGTCGCT182330.21204868711357347No Hit
TTCAAGTAATCCAGGATAGGCTT175110.20365187078625488No Hit
TGAGGTAGTAGGTTGTATAGT170300.19805786988121293No Hit
TGATGTAGTAGGTTGTATAGTT169920.19761593217977516No Hit
AACATTCAACGCTGTCGGTGAGA166120.19319655516539694No Hit
TTTGGTCCCCTTCAACCAGCTG159900.18596273278923048No Hit
TTCCCTTTGTCATCCTATGCCTG155210.18050829115832684No Hit
TACCCTGTAGAACCGAATTTGTG145350.16904117079996656No Hit
TGAGAACTGAATTCCATAGATGG140560.1634704297739477No Hit
TTCACAGTGGCTAAGTTCAGT140400.16328435074176337No Hit
AACATTCATTGCTGTCGGTGGGT139800.16258655437107206No Hit
TCCAGCATCAGTGATTTTGTTG137920.160400125742906No Hit
TGGACGGAGAACTGATAAGGGC135160.15719026243772605No Hit
TTCACAGTGGCTAAGTTCTGCT134770.15673669479677668No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCG134050.15589933915194715No Hit
TGAGGTAGTAGTTTGTATAGTT131600.15305000397162435No Hit
AACATTCAACGCTGTCGGTGG129940.15111943401271177No Hit
TTCACAGTGGTTAAGTTCTGCC125870.14638604863152246No Hit
ACCCTGTAGAACCGAATTTGTGT124960.145327724135974No Hit
AACATTCAACGCTGTCGGTGT121450.1412456153674299No Hit
AACACTCAACGCTGTCGGTGAG119520.13900103704170624No Hit
TGAGATGAAGCACTGTAGCT119230.13866376879587214No Hit
TTCACAGTGGTTAAGTTCTGCCT108760.12648722212730898No Hit
TGAGGTAGTAGGTTGTATAGTTT104930.12203295529439621No Hit
TTCACAGTGGTTAAGTTCTGC104850.12193991577830404No Hit
ACATTAGTCTGCACATTGGTT98080.11406644672900391No Hit
GAGAGAGGCATGATCGTAGCGATAACTA97730.11365939884610066No Hit
TCCCATATGGTCTAGCGGTTAGGATTCC96780.11255455459250611No Hit
AACATTCAACGCTGTCGGTG96750.11251966477397153No Hit
TTCAAAGTGGTTAAGTTCTG95770.11137993070184243No Hit
TATTGCACTTGTCCCGGCCTGTTT95660.11125200136721568No Hit
TTCAGTCATTGTTTCTGGTTGT95100.11060072475457049No Hit
TGTAAACATCCCCGACTGGA93450.10868178473516941No Hit
TCCCTGAGACCCTTAACCTGTGA93220.10841429612640442No Hit
TACCGTGTAGAACCGAATTTGT92450.10751879078401726No Hit
TGAGATGAAGCACTGTAGCTC91700.10664654532065312No Hit
ACAGTAGTCTGCACATTGGTTA89310.10386698977739947No Hit
TATTGCACTTGTCCCGGCCTGTA88990.10349483171303078No Hit
CCCTGTAGAACCGAATTTGCG88660.10311104370915056No Hit
AACCCGTAGATCCGAACTTGTG87200.1014130725404684No Hit
TCCCTGAGACCCTTAACCTGTG87110.10130840308486472No Hit
CAGTGCAATATTAAAAGGGC86620.10073853604880016No Hit
TGAGATGAAGCACTGTAGCTCT86400.10048267737954668No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GATTCGT50.00643864041127.406623
GATTCCT22600.01042.601623
AATAACC900.0939.5055523
TAACTGC3800.0890.0578623
AAATAGC1400.0845.5549323
ATTCGGC8400.0758.315123
TCTGACT58650.0606.4736323
GTACTCT12700.0590.334923
TCTGAGA11250.0561.1979423
TTCTCGC5950.0511.5962823
TAACTAA454.3783075E-9501.069623
ATAACTA11950.0473.1223422
GCTGAGC1550.0472.783423
GGATTCC35800.0455.403622
TCTGATT507.410563E-9450.962623
CATAGCT2400.0399.2898323
GCGCCAA103.65219E-4390.5269821
ACAACCC1100.0376.625422
CGCATTG900.0375.8022223
GCATAGC1500.0373.6714822