FastQCFastQC Report
Wed 7 Dec 2016
nfu_skin_mzm_27_JM66_5_TATAAT_L003_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_27_JM66_5_TATAAT_L003_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17262823
Sequences flagged as poor quality0
Sequence length8-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT11680986.766552608458072No Hit
TTCCCTTTGTCATCCTATGCCT8200204.750208004797361No Hit
AACATTCAACGCTGTCGGTGAG7530914.362502007927672No Hit
AACATTCAACGCTGTCGGTGAGT6936074.017923372092733No Hit
TCCTTCATTCCACCGGAGTCTG5668073.283396927605641No Hit
TACCCTGTAGAACCGAATTTGT4237952.454957685657786No Hit
TGAGGTAGTAGGTTGTATAGTT3906382.262885971778776No Hit
AAGCTGCCAGCTGAAGAACTGT3776092.187411641769136No Hit
AACAGTAAGAGTTTATGTGCTG3274811.8970303987939863No Hit
TACCCTGTAGAACCGAATTTGC3261151.88911744040937No Hit
TAGCTTATCAGACTGGTGTTGGC2874031.6648667486192728No Hit
TCCTTCATTCCACCGGAGTCTGT2540111.4714337278439338No Hit
TACCCTGTAGAACCGAATTTGCG2494351.444925896534999No Hit
CCTGTCTGAGGGTCGCT2359601.3668679798199865No Hit
TATTGCACTTGTCCCGGCCTGT2144351.2421780609115902No Hit
AACATTCAACGCTGTCGGTGA1839611.06564841683194No Hit
TTCACAGTGGCTAAGTTCTG1417980.8214067884493748No Hit
TTCACGTAATCCAGGATAGGCT1294500.7498773520414361No Hit
TTGGTCCCCTTCAACCAGCTGT1266200.7334837413324576No Hit
ACAGTAGTCTGCACATTGGTT1203930.6974120049774014No Hit
TTCACAGTGGTTAAGTTCTG1124880.6516199581030286No Hit
TAACGGAACCCATAATGCAGCTG1094340.6339287612460603No Hit
AAGCTGCCAGCTGAAGAACT1023940.5931474823092376No Hit
ACCCTGTAGAACCGAATTTGCG983530.5697387964876892No Hit
TTTGGTCCCCTTCAACCAGCTGT934720.5414641626111789No Hit
TTCAAGTAATCCAGGATAGGTT881230.5104785005326186No Hit
TTCACAGTGGCTAAGTTCTGC863560.5002426312312882No Hit
TTCAAGTAATCCAGGATAGGC858890.49753739582454154No Hit
TACCCTGTAGATCCGGATTTGT793370.4595830009958395No Hit
TCCTTCATTCCACCGGAGTCT750100.4345175757174826No Hit
TGAGGTAGTAGGTTGTATAGT724210.4195200286766539No Hit
TTCACAGTGGCTAAGTTCAGT683990.39622140596587246No Hit
TGAGGTAGTAGTTTGTATAGTT661450.38316444535172495No Hit
CTACGCCTGTCTGAGGGTCGCT617580.3577514523551565No Hit
TTCCCTTTGTCATCCTATGCCTG614360.35588617226742114No Hit
TTCCAGTGATGACAGCCTATAATCTGACT602980.3492939712120086No Hit
AACTCCAGTCACTATAATATCT592480.34321153614330635RNA PCR Primer, Index 44 (100% over 22bp)
CTGTCTGAGGGTCGCT586950.3400081203404565No Hit
AACTCCAGTCACTATAATATCTCGTATGC563560.3264587721255092RNA PCR Primer, Index 44 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTT560660.32477886148748675No Hit
TTCCATTTGTCATCCTATGCCT550650.31898027338865725No Hit
TGATGTAGTAGGTTGTATAGTT532830.30865751215777393No Hit
TATTGCACTTGTCCCGGCCTGTT498510.28877663867607284No Hit
TGAGGTAGTAGGTTGTATAGTTT488470.2829606721913328No Hit
TGTCTGAGGGTCGCT486190.28163991486212886No Hit
TCCAGTGATGACAGCCTATAATCTGACT479790.27793252586787226No Hit
CATTGCACTTGTCTCGGTCTGA475890.27567333569949715No Hit
TACCCTGTAGAACCGAATTTG472590.27376171324933357No Hit
AAGCTGCCAGCTGAAGAACTGC470510.2725568118262002No Hit
TTCAGTCATTGTTTCTGGTTGT435000.25198659570337945No Hit
TAGCTTATCAGACTGGTGTTGG411900.23860523855223445No Hit
TGAGATGAAGCACTGTAGCTCT404690.23442863313839227No Hit
CCACGTTCCCGTGG404000.23402893026244895No Hit
ATGACCTATGAATTGACAGCC386450.22386257450476088No Hit
CCTTTCTGAGGGTCGCT381800.22116892468862132No Hit
AACTCCAGTCACTATAATATCTCG380970.22068812267842866RNA PCR Primer, Index 44 (100% over 24bp)
TCCAGCATCAGTGATTTTGTT367190.2127056507501699No Hit
ACCCTGTAGAACCGAATTTGC334360.19368790376869416No Hit
TATTGCACTTGTCCCGGCCTGTAT332480.19259885825163128No Hit
TGAGGTAGTAGATTGAATAGTT329250.1907277853685924No Hit
TTCACAGTGGTTAAGTTCTGCC325460.18853231594855605No Hit
AACATTCATTGCTGTCGGTGGG320880.18587921569954113No Hit
AACATTCATTGCTGTCGGTGGGT313920.18184743016828708No Hit
TGGACGGAGAACTGATAAGGGC306860.17775771668399773No Hit
TATTGCACTTGTCCCGGCCTGTA305830.17716105876773455No Hit
TGAGATGAAGCACTGTAGCTC301010.17436893143143506No Hit
TACAGTAGTCTGCACATTGGTT300240.17392288619306356No Hit
ACAGTAGTCTGCACATTGGTTA297520.17234724587050448No Hit
CACCACGTTCCCGTGG294900.17082953350098068No Hit
TACCATGTAGAACCGAATTTGT293330.16992006463832712No Hit
TGTAAACATCCTTGACTGGAAGCT290890.16850662258426677No Hit
TTCACAGTGGCTAAGTTCTGCT290280.1681532620707517No Hit
ATGACCTATGAATTGACAGCCA284670.16490350390547362No Hit
TATTGCACTTGTCCCGGCCTGTTT278280.16120190770652054No Hit
AACATTCAACGCTGTCGGTGAGA269510.15612162622532827No Hit
TTAGGTAGTAGGTTGTATAGTT269220.15595363516152602No Hit
TTCACAGTGGTTAAGTTCTGC259930.15057212832455039No Hit
TTTGGTCCCCTTCAACCAGCTG259370.15024773178755294No Hit
TTCAAGTAATCCAGGATGGGCT253470.14682998255847263No Hit
TATGTGCCCTTGGACTACATCG249150.14432749498734943No Hit
AACTCCAGTCACTATAATATCTC246680.1428966745473785RNA PCR Primer, Index 44 (100% over 23bp)
TCCAGCATCAGTGATTTTGTTG234340.13574836514282745No Hit
CATTATTACTTTTGGTACGCG230520.13353551733688052No Hit
ACCCTGTAGAACCGAATTTGTG229140.13273611158499393No Hit
AACATTCAACGCTGTCGGTGG228450.13233640870905064No Hit
TACCCTGTAGAACCGAATGTGT227730.13191932744719678No Hit
TGAGAACTGAATTCCATAGATGG227310.1316760300444487No Hit
TGTAAACATCCTACACTCTCAGCT225460.1306043629132964No Hit
TACCATGTAGAACCGAATTTGC224530.13006563295006848No Hit
TGAAATGTTTAGGACCACTTGT224030.1297759931848922No Hit
TTCACAGTGGTTAAGTTCTGCCT223670.12956745255396526No Hit
TACCCTGTAGATCCGGATTTGTG213540.12369935091149345No Hit
TGAGATGAAGCACTGTAGCT211260.12237859358228953No Hit
TCCCTGAGACCCTTAACCTGTG208910.12101728668596093No Hit
TTCCCTTTGTCATCCTATGCC206820.119806592467524No Hit
TACAGTACTGTGATAACTGAAG200120.1159254196141616No Hit
ACATTAGTCTGCACATTGGTT199360.11548516717109364No Hit
TTCAAGTAATCCAGGATAGGCA198090.11474948216754584No Hit
CCCTGAGACCCTTAACCTGTGA194530.11268724703949058No Hit
AACCCGTAGATCCGAACTTGTG193210.11192259805942516No Hit
AACATTCAACGCTGTCGGTGT190260.110213723444885No Hit
TCCCTGAGACCCTTAACCTGTGA188700.10931004737753496No Hit
TTGTTCCCCTTCAACCAGCTGT188150.10899144363584101No Hit
TGAGGTAGTTGGTTGTATAGTT178780.10356359443643719No Hit
AACATTCAACGCTGTCGGTG178440.1033666393961173No Hit
TTCCCTTTGTCATCCTATGCCA176760.10239344978512493No Hit
ACCCTGTAGAACCGAATTTGT174860.10129281867745502No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTATGC64350.01040.994423
TAACTAA1700.0905.496323
TAACTGC2950.0899.674823
GATTCCT7350.0772.741123
AATAACC1500.0743.131423
CGCATGC156.145435E-5707.744223
CAACCCG1600.0696.685723
ATAACTA20200.0585.1722
TCGTATG67300.0577.604422
ACAACCC6150.0549.8442422
AAATAGC2900.0549.111923
TCTGACT138250.0532.9198623
GTATGCC1250.0467.1111823
GGATTCC10600.0457.3466222
GACAACC10950.0440.3221
GCTGAGC5450.0428.5423323
TCGGATA252.841095E-4424.646523
TAAAAAA900.0412.8507723
TAATAAC2250.0412.3020622
CTCGTAT93400.0407.8390521