FastQCFastQC Report
Wed 7 Dec 2016
nfu_skin_mzm_27_JM72_5_TACAGC_L006_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
Filenamenfu_skin_mzm_27_JM72_5_TACAGC_L006_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14306782
Sequences flagged as poor quality0
Sequence length8-29
%GC46

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCT12196908.525257461810769No Hit
TACCCTGTAGAACCGAATTTGT8317575.813725266800039No Hit
AACATTCAACGCTGTCGGTGAG6405944.477554770877196No Hit
TACCCTGTAGAACCGAATTTGC5847844.087460059152366No Hit
TTCCCTTTGTCATCCTATGCCT5617673.926578317891473No Hit
TAGCTTATCAGACTGGTGTTGGC5185053.6241902616535286No Hit
AACATTCAACGCTGTCGGTGAGT4641203.244055861059461No Hit
TACCCTGTAGAACCGAATTTGCG3885062.7155372885390996No Hit
TAACGGAACCCATAATGCAGCTG3097912.165343681059794No Hit
AAGCTGCCAGCTGAAGAACTGT2269641.5864084599877177No Hit
TCCTTCATTCCACCGGAGTCTG2234591.5619095894520514No Hit
AACAGTAAGAGTTTATGTGCTG2088051.4594826425676997No Hit
TTCACAGTGGCTAAGTTCTG1775121.240754210136144No Hit
ACCCTGTAGAACCGAATTTGCG1590531.1117314851096494No Hit
TGAGGTAGTAGGTTGTATAGTT1557881.0889101406591641No Hit
TATTGCACTTGTCCCGGCCTGT1549611.083129665357311No Hit
TTCACAGTGGTTAAGTTCTG1464461.0236124377934883No Hit
AACATTCAACGCTGTCGGTGA1455841.0175873232708794No Hit
TTGGTCCCCTTCAACCAGCTGT1258940.8799602873658101No Hit
TACCCTGTAGAACCGAATGTGT1041300.7278366302079671No Hit
TTTGGTCCCCTTCAACCAGCTGT966840.6757913834152222No Hit
ACAGTAGTCTGCACATTGGTT951360.664971340165804No Hit
TCCTTCATTCCACCGGAGTCTGT943360.6593795865485333No Hit
TTCAAGTAATCCAGGATAGGC853460.5965422552744565No Hit
TACCCTGTAGAACCGAATTTG807980.564753135960274No Hit
AACTCCAGTCACTACAGCATCTCGTATGC782700.5470831945296992RNA PCR Primer, Index 43 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGC746090.5214939320386653No Hit
AAGCTGCCAGCTGAAGAACT733630.5127847757797666No Hit
ACCCTGTAGAACCGAATTTGC706240.4936400093326368No Hit
CATTGCACTTGTCTCGGTCTGA683410.4776825424473512No Hit
TGAGATGAAGCACTGTAGCTCT656520.45888726060130086No Hit
TGAGATGAAGCACTGTAGCT643510.4497936712812147No Hit
TTCCAGTGATGACAGCCTATAATCTGACT590290.41259453034232296No Hit
TGAGATGAAGCACTGTAGCTC583430.4077996016155136No Hit
TCCAGCATCAGTGATTTTGTT565280.3951133105963312No Hit
AAGCTGCCAGCTGAAGAACTGC565020.3949315786037699No Hit
CCTGTCTGAGGGTCGCT559230.3908845469232704No Hit
CATTATTACTTTTGGTACGCG535690.37443081190445204No Hit
TTCAAGTAATCCAGGATAGGCTT532510.37220808984158704No Hit
TACCCTGTAGATCCGGATTTGT502520.3512460034688444No Hit
TTCCCTTTGTCATCCTATGCCTG489380.34206154815247763No Hit
TTCAAGTAATCCAGGATAGGTT477080.3334642269659243No Hit
TAGCTTATCAGACTGGTGTTGG464970.3249997099277811No Hit
TATTGCACTTGTCCCGGCCTGTAT463230.32378350351602475No Hit
TATTGCACTTGTCCCGGCCTGTT446180.3118660786192171No Hit
TGAGGTAGTAGGTTGTATAGT430910.3011928189022521No Hit
TGAGAACTGAATTCCATAGATGG418990.29286110601251913No Hit
TCCAGTGATGACAGCCTATAATCTGACT407560.28487188803184393No Hit
ACCCTGTAGAACCGAATTTGTG374080.261470399143567No Hit
ACCCTGTAGAACCGAATTTGT372970.26069454332917075No Hit
TATTGCACTTGTCCCGGCCTGTA370700.25910788324027023No Hit
AATGACACGTTTTCTCCCGGATT355450.24844860290734844No Hit
TTCACAGTGGCTAAGTTCTGCT337410.2358391985004035No Hit
TGTAAACATCCCCGACTGGA318880.22288729918440078No Hit
TTCAAGTAATCCAGGATGGGCT315920.22081835034601072No Hit
GAGAGAGGCATGATCGTAGCGATAACTA312880.21869348397144794No Hit
TACCCTGTAGAACCGAATTTGTG280460.19603290243745938No Hit
CCCTGAGACCCTTAACCTGTGA278900.19494251048209163No Hit
TGAGGTAGTAGGTTGTATAGTTT269790.18857490105042488No Hit
CACCACGTTCCCGTGG268170.18744257094292763No Hit
TGAGGTAGTAGTTTGTATAGTT268030.1873447152546254No Hit
TTCACAGTGGCTAAGTTCAGT264110.18460475598216286No Hit
TTCACAGTGGTTAAGTTCTGCCT250380.17500790883652242No Hit
AACATTCAACGCTGTCGGTGAGA248190.17347716628379464No Hit
TCCCTGAGACCCTTAACCTGTGA247890.173267475523147No Hit
AACATTCAACGCTGTCGGTGT246670.17241473309651326No Hit
TATTGCACTTGTCCCGGCCTGTTT245260.17142918652146932No Hit
TTCACAGTGGTTAAGTTCTGCC243550.17023394918577775No Hit
AACATTCAACGCTGTCGGTGG241560.16884300047348175No Hit
AACATTCATTGCTGTCGGTGGG240020.16776658790215718No Hit
TCCTTCATTCCACCGGAGTCT237110.16573258752387504No Hit
TCCAGCATCAGTGATTTTGTTG236520.16532019569460135No Hit
TGTGGTCGGCGTCC226350.15821167890864626No Hit
TGGACGGAGAACTGATAAGGGC226240.15813479229640878No Hit
AATGACACGTTTTCTCCCGGATTG225130.15735893648201252No Hit
TATTGCACTTGTCCCGGCCTGTAA216050.15101229612641054No Hit
TATGTGCCCTTGGACTACATCG215530.15064883214128796No Hit
TCCCTGAGACCCTTAACCTGTG214100.14964930618220088No Hit
ACAGTAGTCTGCACATTGGTTA203450.14220528417920955No Hit
TTTGGTCCCCTTCAACCAGCTG201180.14061862409030904No Hit
AACATTCATTGCTGTCGGTGGGT199660.13955619090302768No Hit
ACCCTGTAGAACCGAATTTGTGT189600.13252456072931007No Hit
TACAGTAGTCTGCACATTGGTT186060.13005020975366788No Hit
CCCAGTGTTCAGACTACCTGTT185290.1295120034680056No Hit
TCCCTGAGACCCTTAACCTGT183520.12827482798018452No Hit
TTCACAGTGGTTAAGTTCTGC182100.12728229171311897No Hit
CTTCATGATGATCTCAAGAGTTCTGACA170630.11926511496435747No Hit
CCCAGTGTTCAGACTACCTGT165810.115896083409952No Hit
GAGAGAGGCATGATCGTAGCGATAACTGA165260.11551165034876466No Hit
TAACTGAACCCATAATGCAGCTG163660.11439329962531057No Hit
CTTTCAGTCGGATGTTTGCAGC162840.11382014487954036No Hit
AACATTCAACGCTGTCGGTG159100.1112060000634664No Hit
CTCGGTTCTGGTGTCAAGCGCCCGGC153400.10722187561116119No Hit
CCCTGTAGAACCGAATTTGCG151840.10613148365579345No Hit
AATGACACGTTTTCTCCCGGAT151450.10585888566695151No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAACTAA1000.0878.4848623
CGTATGC91800.0859.824223
CAACCCG400.0658.8636523
GATTCCT8950.0613.4670423
AAATAGC1600.0603.958323
TAACACC450.0585.6565623
TAACTGC7950.0558.0312523
ATAACTA35050.0515.642722
TCGTATG93400.0503.553422
TCTGACT118550.0486.4827623
AATAACC750.0468.525223
ACAACCC1050.0443.2440222
ATAAACC600.0430.931722
GGATTCC9600.0428.2383722
CTCGTAT95450.0415.0798321
ATAAAAA1450.0410.128122
GTACTCT1550.0396.735123
GATAACA8000.0394.034621
GATAAAA8950.0388.395621
TCTGAGA16950.0386.1186823